Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635917_at:

>probe:Drosophila_2:1635917_at:464:85; Interrogation_Position=23; Antisense; AGTGCCACCACCAACTAGTTCTTTC
>probe:Drosophila_2:1635917_at:261:261; Interrogation_Position=31; Antisense; CACCAACTAGTTCTTTCCTCCAAGT
>probe:Drosophila_2:1635917_at:644:137; Interrogation_Position=36; Antisense; ACTAGTTCTTTCCTCCAAGTCCCAT
>probe:Drosophila_2:1635917_at:248:613; Interrogation_Position=49; Antisense; TCCAAGTCCCATCTTTCTTTTTTGA
>probe:Drosophila_2:1635917_at:686:251; Interrogation_Position=51; Antisense; CAAGTCCCATCTTTCTTTTTTGACG
>probe:Drosophila_2:1635917_at:201:87; Interrogation_Position=53; Antisense; AGTCCCATCTTTCTTTTTTGACGTG
>probe:Drosophila_2:1635917_at:508:631; Interrogation_Position=55; Antisense; TCCCATCTTTCTTTTTTGACGTGAC
>probe:Drosophila_2:1635917_at:222:307; Interrogation_Position=57; Antisense; CCATCTTTCTTTTTTGACGTGACCA
>probe:Drosophila_2:1635917_at:101:33; Interrogation_Position=59; Antisense; ATCTTTCTTTTTTGACGTGACCAGC
>probe:Drosophila_2:1635917_at:226:277; Interrogation_Position=61; Antisense; CTTTCTTTTTTGACGTGACCAGCGA
>probe:Drosophila_2:1635917_at:185:713; Interrogation_Position=63; Antisense; TTCTTTTTTGACGTGACCAGCGAGA
>probe:Drosophila_2:1635917_at:131:277; Interrogation_Position=65; Antisense; CTTTTTTGACGTGACCAGCGAGAAA
>probe:Drosophila_2:1635917_at:198:687; Interrogation_Position=69; Antisense; TTTGACGTGACCAGCGAGAAAAATG
>probe:Drosophila_2:1635917_at:79:139; Interrogation_Position=73; Antisense; ACGTGACCAGCGAGAAAAATGGTGA

Paste this into a BLAST search page for me
AGTGCCACCACCAACTAGTTCTTTCCACCAACTAGTTCTTTCCTCCAAGTACTAGTTCTTTCCTCCAAGTCCCATTCCAAGTCCCATCTTTCTTTTTTGACAAGTCCCATCTTTCTTTTTTGACGAGTCCCATCTTTCTTTTTTGACGTGTCCCATCTTTCTTTTTTGACGTGACCCATCTTTCTTTTTTGACGTGACCAATCTTTCTTTTTTGACGTGACCAGCCTTTCTTTTTTGACGTGACCAGCGATTCTTTTTTGACGTGACCAGCGAGACTTTTTTGACGTGACCAGCGAGAAATTTGACGTGACCAGCGAGAAAAATGACGTGACCAGCGAGAAAAATGGTGA

Full Affymetrix probeset data:

Annotations for 1635917_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime