Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635918_at:

>probe:Drosophila_2:1635918_at:604:243; Interrogation_Position=8047; Antisense; AATATTCGAAATAAACTGCCAGGAT
>probe:Drosophila_2:1635918_at:537:193; Interrogation_Position=8060; Antisense; AACTGCCAGGATTTCTTTTGCTTCG
>probe:Drosophila_2:1635918_at:195:459; Interrogation_Position=8069; Antisense; GATTTCTTTTGCTTCGACCTACATA
>probe:Drosophila_2:1635918_at:272:693; Interrogation_Position=8076; Antisense; TTTGCTTCGACCTACATATATGTGT
>probe:Drosophila_2:1635918_at:476:151; Interrogation_Position=8089; Antisense; ACATATATGTGTCCGTCTTTTCCGA
>probe:Drosophila_2:1635918_at:399:589; Interrogation_Position=8096; Antisense; TGTGTCCGTCTTTTCCGACTTTATA
>probe:Drosophila_2:1635918_at:375:719; Interrogation_Position=8108; Antisense; TTCCGACTTTATAACGACCGAGCAA
>probe:Drosophila_2:1635918_at:44:677; Interrogation_Position=8117; Antisense; TATAACGACCGAGCAAAGACAGATC
>probe:Drosophila_2:1635918_at:391:451; Interrogation_Position=8138; Antisense; GATCGAAATCATTATGCTCGCACAC
>probe:Drosophila_2:1635918_at:154:705; Interrogation_Position=8149; Antisense; TTATGCTCGCACACATGCACACACA
>probe:Drosophila_2:1635918_at:717:427; Interrogation_Position=8246; Antisense; GAGTTTAGCTAAATCATCAGAAGAG
>probe:Drosophila_2:1635918_at:52:681; Interrogation_Position=8400; Antisense; TTTTAATGGTTTTTATATCGACGCA
>probe:Drosophila_2:1635918_at:188:683; Interrogation_Position=8415; Antisense; TATCGACGCATATAAAACATTCTTA
>probe:Drosophila_2:1635918_at:154:589; Interrogation_Position=8549; Antisense; TGGATTTATTTCAAAACACGCAGTG

Paste this into a BLAST search page for me
AATATTCGAAATAAACTGCCAGGATAACTGCCAGGATTTCTTTTGCTTCGGATTTCTTTTGCTTCGACCTACATATTTGCTTCGACCTACATATATGTGTACATATATGTGTCCGTCTTTTCCGATGTGTCCGTCTTTTCCGACTTTATATTCCGACTTTATAACGACCGAGCAATATAACGACCGAGCAAAGACAGATCGATCGAAATCATTATGCTCGCACACTTATGCTCGCACACATGCACACACAGAGTTTAGCTAAATCATCAGAAGAGTTTTAATGGTTTTTATATCGACGCATATCGACGCATATAAAACATTCTTATGGATTTATTTCAAAACACGCAGTG

Full Affymetrix probeset data:

Annotations for 1635918_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime