FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635919_at:

>probe:Drosophila_2:1635919_at:130:469; Interrogation_Position=349; Antisense; GTTGCGACCCGTCTATTTACCTGAA
>probe:Drosophila_2:1635919_at:371:689; Interrogation_Position=362; Antisense; TATTTACCTGAACCTGAGCTGTCTG
>probe:Drosophila_2:1635919_at:191:419; Interrogation_Position=377; Antisense; GAGCTGTCTGGACTACACTCTTTAA
>probe:Drosophila_2:1635919_at:469:481; Interrogation_Position=477; Antisense; GTATTCAAACATATCGCCATGCTGG
>probe:Drosophila_2:1635919_at:487:671; Interrogation_Position=534; Antisense; TACGTCTTTATGTCGCTGCTGGTGC
>probe:Drosophila_2:1635919_at:405:585; Interrogation_Position=553; Antisense; TGGTGCTCATTGTGTGCTTCATACT
>probe:Drosophila_2:1635919_at:699:63; Interrogation_Position=583; Antisense; ATGTGGTCCACAAGCTGTATCGCAG
>probe:Drosophila_2:1635919_at:235:591; Interrogation_Position=634; Antisense; TGGTTTCTCCGGCACAGCAGCTGAA
>probe:Drosophila_2:1635919_at:64:115; Interrogation_Position=649; Antisense; AGCAGCTGAAGACCTCCATCATGGA
>probe:Drosophila_2:1635919_at:238:419; Interrogation_Position=672; Antisense; GAGCTAGACGCCATGAAGACCGGTT
>probe:Drosophila_2:1635919_at:211:111; Interrogation_Position=733; Antisense; AGAATCTCAAGTCTCAGTCTCCGAT
>probe:Drosophila_2:1635919_at:507:293; Interrogation_Position=754; Antisense; CGATGTCAGAGCTCCGGTTTTAATT
>probe:Drosophila_2:1635919_at:229:61; Interrogation_Position=794; Antisense; ATGTACGACGAACGACAGCTGCTGA
>probe:Drosophila_2:1635919_at:66:131; Interrogation_Position=843; Antisense; ACCTAGACGCCTGTTGATATGTTAA

Paste this into a BLAST search page for me
GTTGCGACCCGTCTATTTACCTGAATATTTACCTGAACCTGAGCTGTCTGGAGCTGTCTGGACTACACTCTTTAAGTATTCAAACATATCGCCATGCTGGTACGTCTTTATGTCGCTGCTGGTGCTGGTGCTCATTGTGTGCTTCATACTATGTGGTCCACAAGCTGTATCGCAGTGGTTTCTCCGGCACAGCAGCTGAAAGCAGCTGAAGACCTCCATCATGGAGAGCTAGACGCCATGAAGACCGGTTAGAATCTCAAGTCTCAGTCTCCGATCGATGTCAGAGCTCCGGTTTTAATTATGTACGACGAACGACAGCTGCTGAACCTAGACGCCTGTTGATATGTTAA

Full Affymetrix probeset data:

Annotations for 1635919_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720