Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635921_at:

>probe:Drosophila_2:1635921_at:605:625; Interrogation_Position=2533; Antisense; TGCCCTCCGATTTCCAGAAGGTTGC
>probe:Drosophila_2:1635921_at:623:109; Interrogation_Position=2548; Antisense; AGAAGGTTGCTTACTGCTCGCTACT
>probe:Drosophila_2:1635921_at:719:481; Interrogation_Position=2604; Antisense; GTATTCGGACTGTTCCAGAACTCCA
>probe:Drosophila_2:1635921_at:477:223; Interrogation_Position=2645; Antisense; AAGGATATTGGCATCTGCGCTCGGT
>probe:Drosophila_2:1635921_at:275:623; Interrogation_Position=2660; Antisense; TGCGCTCGGTTGTGTTCGTAACTTT
>probe:Drosophila_2:1635921_at:302:613; Interrogation_Position=2704; Antisense; TGAACTACACACTTGAATCCGACGA
>probe:Drosophila_2:1635921_at:274:391; Interrogation_Position=2729; Antisense; GAAACTGCTCGGTGATTGCTATATG
>probe:Drosophila_2:1635921_at:109:539; Interrogation_Position=2789; Antisense; GGTTTCTCCCACAGCAAACTATATT
>probe:Drosophila_2:1635921_at:444:203; Interrogation_Position=2816; Antisense; AAGCCATGCCAAGAAACTCGGTGAA
>probe:Drosophila_2:1635921_at:458:101; Interrogation_Position=2855; Antisense; AGAGCTCACGGGACTTTTGCTTAGT
>probe:Drosophila_2:1635921_at:366:479; Interrogation_Position=2878; Antisense; GTTTGGCTCAAAATCTTCGAAGTAC
>probe:Drosophila_2:1635921_at:328:375; Interrogation_Position=2952; Antisense; GAAGAACCTCTGAAGAAAGCCCTCT
>probe:Drosophila_2:1635921_at:685:335; Interrogation_Position=3013; Antisense; GCTCCAGCGATTTTATCGAGGCTAT
>probe:Drosophila_2:1635921_at:164:159; Interrogation_Position=3107; Antisense; AAATAGGGCCATGCATTTAGACCTC

Paste this into a BLAST search page for me
TGCCCTCCGATTTCCAGAAGGTTGCAGAAGGTTGCTTACTGCTCGCTACTGTATTCGGACTGTTCCAGAACTCCAAAGGATATTGGCATCTGCGCTCGGTTGCGCTCGGTTGTGTTCGTAACTTTTGAACTACACACTTGAATCCGACGAGAAACTGCTCGGTGATTGCTATATGGGTTTCTCCCACAGCAAACTATATTAAGCCATGCCAAGAAACTCGGTGAAAGAGCTCACGGGACTTTTGCTTAGTGTTTGGCTCAAAATCTTCGAAGTACGAAGAACCTCTGAAGAAAGCCCTCTGCTCCAGCGATTTTATCGAGGCTATAAATAGGGCCATGCATTTAGACCTC

Full Affymetrix probeset data:

Annotations for 1635921_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime