FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635923_at:

>probe:Drosophila_2:1635923_at:720:363; Interrogation_Position=356; Antisense; GAATATCACGCAGGATGGCCGATCA
>probe:Drosophila_2:1635923_at:697:439; Interrogation_Position=369; Antisense; GATGGCCGATCAGTCTCTCCAGAAG
>probe:Drosophila_2:1635923_at:133:109; Interrogation_Position=389; Antisense; AGAAGCCTGGATGCGGCTGTTCTGT
>probe:Drosophila_2:1635923_at:477:333; Interrogation_Position=404; Antisense; GCTGTTCTGTGTGTTCTTCAACGGA
>probe:Drosophila_2:1635923_at:226:371; Interrogation_Position=446; Antisense; GAAGTTCGCATTTGAGGTTTATACA
>probe:Drosophila_2:1635923_at:305:499; Interrogation_Position=504; Antisense; GTCGGCGTGGCCATTGAACAATTCT
>probe:Drosophila_2:1635923_at:76:327; Interrogation_Position=563; Antisense; GCGAGCGGACATGTGCGAGTTCATA
>probe:Drosophila_2:1635923_at:640:365; Interrogation_Position=653; Antisense; GAATCAGCCTGGATTGCTCGAGTTT
>probe:Drosophila_2:1635923_at:98:155; Interrogation_Position=706; Antisense; ACAGATCACTGGTGGCGTACTGCCA
>probe:Drosophila_2:1635923_at:577:327; Interrogation_Position=720; Antisense; GCGTACTGCCACAACATTGAGTCTA
>probe:Drosophila_2:1635923_at:394:5; Interrogation_Position=735; Antisense; ATTGAGTCTATGTTTCCGCCAGAAG
>probe:Drosophila_2:1635923_at:217:249; Interrogation_Position=820; Antisense; AATTGTATACATTCTCAGCCTGCTA
>probe:Drosophila_2:1635923_at:51:249; Interrogation_Position=879; Antisense; AATTGGCGCTTAGAGGCCTGCAAGC
>probe:Drosophila_2:1635923_at:245:361; Interrogation_Position=898; Antisense; GCAAGCCGGCTTACAATAAAGTCAT

Paste this into a BLAST search page for me
GAATATCACGCAGGATGGCCGATCAGATGGCCGATCAGTCTCTCCAGAAGAGAAGCCTGGATGCGGCTGTTCTGTGCTGTTCTGTGTGTTCTTCAACGGAGAAGTTCGCATTTGAGGTTTATACAGTCGGCGTGGCCATTGAACAATTCTGCGAGCGGACATGTGCGAGTTCATAGAATCAGCCTGGATTGCTCGAGTTTACAGATCACTGGTGGCGTACTGCCAGCGTACTGCCACAACATTGAGTCTAATTGAGTCTATGTTTCCGCCAGAAGAATTGTATACATTCTCAGCCTGCTAAATTGGCGCTTAGAGGCCTGCAAGCGCAAGCCGGCTTACAATAAAGTCAT

Full Affymetrix probeset data:

Annotations for 1635923_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720