FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635924_at:

>probe:Drosophila_2:1635924_at:358:251; Interrogation_Position=1026; Antisense; CAAGGACTTCGGACGCGATGGCAGC
>probe:Drosophila_2:1635924_at:315:291; Interrogation_Position=1076; Antisense; CGTGCTTCTATTCGCCCGGAAAGAA
>probe:Drosophila_2:1635924_at:510:519; Interrogation_Position=1111; Antisense; GTGGCCCGATTCGACCTGGAGGTCA
>probe:Drosophila_2:1635924_at:597:435; Interrogation_Position=1129; Antisense; GAGGTCACCTATCGCCAGTTTGTGT
>probe:Drosophila_2:1635924_at:414:691; Interrogation_Position=1147; Antisense; TTTGTGTTCGCCTCGGTAGTGCCAT
>probe:Drosophila_2:1635924_at:107:87; Interrogation_Position=1164; Antisense; AGTGCCATCGGTTCTGTTCGTGGTC
>probe:Drosophila_2:1635924_at:656:603; Interrogation_Position=1192; Antisense; TGTTCCATCCTGATCATGTGCCAGA
>probe:Drosophila_2:1635924_at:23:241; Interrogation_Position=1285; Antisense; AATAAGAACAACGTGGGCGCACCCA
>probe:Drosophila_2:1635924_at:8:57; Interrogation_Position=766; Antisense; ATGACATCGTGTTACTTCATCAGGC
>probe:Drosophila_2:1635924_at:344:619; Interrogation_Position=820; Antisense; TGCATCAATGGCTCCACGCTGGAGA
>probe:Drosophila_2:1635924_at:22:589; Interrogation_Position=839; Antisense; TGGAGACCAATATGCTCAGCGATCT
>probe:Drosophila_2:1635924_at:181:649; Interrogation_Position=854; Antisense; TCAGCGATCTGACCAACTTCACATA
>probe:Drosophila_2:1635924_at:280:151; Interrogation_Position=874; Antisense; ACATATCTGAGCCACCTGCACGTGT
>probe:Drosophila_2:1635924_at:368:19; Interrogation_Position=949; Antisense; ATTTCCAACGAGTCCAAGCTGATGA

Paste this into a BLAST search page for me
CAAGGACTTCGGACGCGATGGCAGCCGTGCTTCTATTCGCCCGGAAAGAAGTGGCCCGATTCGACCTGGAGGTCAGAGGTCACCTATCGCCAGTTTGTGTTTTGTGTTCGCCTCGGTAGTGCCATAGTGCCATCGGTTCTGTTCGTGGTCTGTTCCATCCTGATCATGTGCCAGAAATAAGAACAACGTGGGCGCACCCAATGACATCGTGTTACTTCATCAGGCTGCATCAATGGCTCCACGCTGGAGATGGAGACCAATATGCTCAGCGATCTTCAGCGATCTGACCAACTTCACATAACATATCTGAGCCACCTGCACGTGTATTTCCAACGAGTCCAAGCTGATGA

Full Affymetrix probeset data:

Annotations for 1635924_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720