FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635925_at:

>probe:Drosophila_2:1635925_at:396:697; Interrogation_Position=1014; Antisense; TTTCATCTATGAAGCCGCCGCTAGA
>probe:Drosophila_2:1635925_at:604:319; Interrogation_Position=1030; Antisense; GCCGCTAGAATCTCACCTATGATGG
>probe:Drosophila_2:1635925_at:241:55; Interrogation_Position=1076; Antisense; ATGAATTGCGCATCATGGACGCCAT
>probe:Drosophila_2:1635925_at:680:601; Interrogation_Position=1139; Antisense; TGTTCGACTTCAACAGCCTGGAGAT
>probe:Drosophila_2:1635925_at:698:493; Interrogation_Position=1186; Antisense; GTCAACCTATTACCGATCCATTTGT
>probe:Drosophila_2:1635925_at:12:667; Interrogation_Position=697; Antisense; TACATTTGCTCCAGGCTTTATCGTG
>probe:Drosophila_2:1635925_at:31:149; Interrogation_Position=747; Antisense; ACTTTATTCGTGTGCCGTGGACATC
>probe:Drosophila_2:1635925_at:362:151; Interrogation_Position=767; Antisense; ACATCTGGAGTGCTGGTTGCGTCCT
>probe:Drosophila_2:1635925_at:471:119; Interrogation_Position=797; Antisense; AGCTGCTCAAGGGATATCCGCTCTT
>probe:Drosophila_2:1635925_at:225:393; Interrogation_Position=842; Antisense; GAAAGCAGCTGCGACTCATCGTTAA
>probe:Drosophila_2:1635925_at:302:441; Interrogation_Position=880; Antisense; GATGGCTTGGAACGAGCTCCTGAAA
>probe:Drosophila_2:1635925_at:138:413; Interrogation_Position=939; Antisense; GACCACTCGTCCCAGTTGGAATTAT
>probe:Drosophila_2:1635925_at:22:365; Interrogation_Position=957; Antisense; GAATTATCTCCTGAATACGGCTGTT
>probe:Drosophila_2:1635925_at:129:79; Interrogation_Position=986; Antisense; AGGATCTGTGCGGTCTGTTGAACTC

Paste this into a BLAST search page for me
TTTCATCTATGAAGCCGCCGCTAGAGCCGCTAGAATCTCACCTATGATGGATGAATTGCGCATCATGGACGCCATTGTTCGACTTCAACAGCCTGGAGATGTCAACCTATTACCGATCCATTTGTTACATTTGCTCCAGGCTTTATCGTGACTTTATTCGTGTGCCGTGGACATCACATCTGGAGTGCTGGTTGCGTCCTAGCTGCTCAAGGGATATCCGCTCTTGAAAGCAGCTGCGACTCATCGTTAAGATGGCTTGGAACGAGCTCCTGAAAGACCACTCGTCCCAGTTGGAATTATGAATTATCTCCTGAATACGGCTGTTAGGATCTGTGCGGTCTGTTGAACTC

Full Affymetrix probeset data:

Annotations for 1635925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720