Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635926_at:

>probe:Drosophila_2:1635926_at:695:371; Interrogation_Position=118; Antisense; GAAGGACCCGTCCACAAGAGCCTGG
>probe:Drosophila_2:1635926_at:192:595; Interrogation_Position=140; Antisense; TGGGCTACGGATACGATCACGATGT
>probe:Drosophila_2:1635926_at:281:35; Interrogation_Position=155; Antisense; ATCACGATGTGGTCAGCGCTTACGG
>probe:Drosophila_2:1635926_at:638:121; Interrogation_Position=169; Antisense; AGCGCTTACGGTGGCATCTACGGAC
>probe:Drosophila_2:1635926_at:161:235; Interrogation_Position=17; Antisense; AATCCTTTAGCGGAGGTCTGTTCTT
>probe:Drosophila_2:1635926_at:539:83; Interrogation_Position=205; Antisense; AGTGTCGGCCATTCGGGCTACGGAT
>probe:Drosophila_2:1635926_at:563:485; Interrogation_Position=267; Antisense; GTACCAATTCGACTACGGCGTCAAG
>probe:Drosophila_2:1635926_at:106:225; Interrogation_Position=289; Antisense; AAGGATGCCCACACCGGAGACCAGA
>probe:Drosophila_2:1635926_at:369:111; Interrogation_Position=355; Antisense; AGCTACTCCCTCAAGGAATCGGATG
>probe:Drosophila_2:1635926_at:592:307; Interrogation_Position=465; Antisense; CCAGGTCTACCACAAGGGCTACGGA
>probe:Drosophila_2:1635926_at:141:83; Interrogation_Position=479; Antisense; AGGGCTACGGACACGGCGATATCTA
>probe:Drosophila_2:1635926_at:181:339; Interrogation_Position=518; Antisense; GCTACGGTCACGATGTGGCGCAATA
>probe:Drosophila_2:1635926_at:582:545; Interrogation_Position=565; Antisense; GGAGGCCACGCCAGTAGCTACGTAA
>probe:Drosophila_2:1635926_at:612:127; Interrogation_Position=91; Antisense; ACCAGCTACAGTTCGGTGACCAAGC

Paste this into a BLAST search page for me
GAAGGACCCGTCCACAAGAGCCTGGTGGGCTACGGATACGATCACGATGTATCACGATGTGGTCAGCGCTTACGGAGCGCTTACGGTGGCATCTACGGACAATCCTTTAGCGGAGGTCTGTTCTTAGTGTCGGCCATTCGGGCTACGGATGTACCAATTCGACTACGGCGTCAAGAAGGATGCCCACACCGGAGACCAGAAGCTACTCCCTCAAGGAATCGGATGCCAGGTCTACCACAAGGGCTACGGAAGGGCTACGGACACGGCGATATCTAGCTACGGTCACGATGTGGCGCAATAGGAGGCCACGCCAGTAGCTACGTAAACCAGCTACAGTTCGGTGACCAAGC

Full Affymetrix probeset data:

Annotations for 1635926_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime