Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635927_at:

>probe:Drosophila_2:1635927_at:347:261; Interrogation_Position=3642; Antisense; CAGCGCCAGACGGTTTTGTGGGCAA
>probe:Drosophila_2:1635927_at:675:521; Interrogation_Position=3672; Antisense; GTGGCGGCTTTATCGAGCGCTAGTC
>probe:Drosophila_2:1635927_at:475:289; Interrogation_Position=3719; Antisense; CGGCATTCTCAGTGGCGTGGTCGAT
>probe:Drosophila_2:1635927_at:35:517; Interrogation_Position=3735; Antisense; GTGGTCGATGGTTCACCCTTTATTC
>probe:Drosophila_2:1635927_at:288:689; Interrogation_Position=3755; Antisense; TATTCTCACCGGCAGTTCGGATCAG
>probe:Drosophila_2:1635927_at:497:545; Interrogation_Position=3781; Antisense; GGATCCGGTACTGGGACATCACCAA
>probe:Drosophila_2:1635927_at:60:699; Interrogation_Position=3823; Antisense; TTAAAGTACCCGCTGCCAATGACAA
>probe:Drosophila_2:1635927_at:667:201; Interrogation_Position=3846; Antisense; AACCTGGCAGATGTGGCTTTCAACT
>probe:Drosophila_2:1635927_at:298:341; Interrogation_Position=3861; Antisense; GCTTTCAACTATGGTGCCCGGTTAA
>probe:Drosophila_2:1635927_at:136:301; Interrogation_Position=3877; Antisense; CCCGGTTAATCGATGGCAGCCAAGT
>probe:Drosophila_2:1635927_at:490:421; Interrogation_Position=3909; Antisense; GAGCAAATCATTTCCATGGCCAGCA
>probe:Drosophila_2:1635927_at:396:397; Interrogation_Position=4044; Antisense; GACAAGGGCCAGATCTACATAGCAT
>probe:Drosophila_2:1635927_at:489:675; Interrogation_Position=4063; Antisense; TAGCATCTGCATCGCGAAACGGTGT
>probe:Drosophila_2:1635927_at:449:391; Interrogation_Position=4078; Antisense; GAAACGGTGTCATCAAGCTGTGGAA

Paste this into a BLAST search page for me
CAGCGCCAGACGGTTTTGTGGGCAAGTGGCGGCTTTATCGAGCGCTAGTCCGGCATTCTCAGTGGCGTGGTCGATGTGGTCGATGGTTCACCCTTTATTCTATTCTCACCGGCAGTTCGGATCAGGGATCCGGTACTGGGACATCACCAATTAAAGTACCCGCTGCCAATGACAAAACCTGGCAGATGTGGCTTTCAACTGCTTTCAACTATGGTGCCCGGTTAACCCGGTTAATCGATGGCAGCCAAGTGAGCAAATCATTTCCATGGCCAGCAGACAAGGGCCAGATCTACATAGCATTAGCATCTGCATCGCGAAACGGTGTGAAACGGTGTCATCAAGCTGTGGAA

Full Affymetrix probeset data:

Annotations for 1635927_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime