FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635929_at:

>probe:Drosophila_2:1635929_at:616:623; Interrogation_Position=105; Antisense; TGCGCTCTGGGATTTGCACTCGAAA
>probe:Drosophila_2:1635929_at:112:655; Interrogation_Position=132; Antisense; TAATTGTGCTAATTGCCAGCCGCTT
>probe:Drosophila_2:1635929_at:208:721; Interrogation_Position=144; Antisense; TTGCCAGCCGCTTGAACGATACCAG
>probe:Drosophila_2:1635929_at:121:457; Interrogation_Position=161; Antisense; GATACCAGCTACTCGTATCATCCTG
>probe:Drosophila_2:1635929_at:412:45; Interrogation_Position=180; Antisense; ATCCTGCCATACACGATGAGACTTT
>probe:Drosophila_2:1635929_at:305:53; Interrogation_Position=195; Antisense; ATGAGACTTTTGTCCGGCGGAAGCA
>probe:Drosophila_2:1635929_at:313:563; Interrogation_Position=213; Antisense; GGAAGCAGCGTCGAAATCGCACCAC
>probe:Drosophila_2:1635929_at:611:129; Interrogation_Position=236; Antisense; ACCTTCACACTGCAACAGGCTGGAG
>probe:Drosophila_2:1635929_at:67:395; Interrogation_Position=24; Antisense; GAAATCCTCCATTGGCTCGGGTTTT
>probe:Drosophila_2:1635929_at:300:265; Interrogation_Position=282; Antisense; CAGACCCACTATCCGGATGTATTTA
>probe:Drosophila_2:1635929_at:611:181; Interrogation_Position=327; Antisense; AAAATCAACCTGACCGAAGCACGGG
>probe:Drosophila_2:1635929_at:697:537; Interrogation_Position=43; Antisense; GGTTTTGGCCAAAGCTTTCAGCATG
>probe:Drosophila_2:1635929_at:384:395; Interrogation_Position=67; Antisense; GAAATTCTTATTGCCCAGTTTTTGG
>probe:Drosophila_2:1635929_at:200:267; Interrogation_Position=82; Antisense; CAGTTTTTGGGCAGCTTTGGCTCTG

Paste this into a BLAST search page for me
TGCGCTCTGGGATTTGCACTCGAAATAATTGTGCTAATTGCCAGCCGCTTTTGCCAGCCGCTTGAACGATACCAGGATACCAGCTACTCGTATCATCCTGATCCTGCCATACACGATGAGACTTTATGAGACTTTTGTCCGGCGGAAGCAGGAAGCAGCGTCGAAATCGCACCACACCTTCACACTGCAACAGGCTGGAGGAAATCCTCCATTGGCTCGGGTTTTCAGACCCACTATCCGGATGTATTTAAAAATCAACCTGACCGAAGCACGGGGGTTTTGGCCAAAGCTTTCAGCATGGAAATTCTTATTGCCCAGTTTTTGGCAGTTTTTGGGCAGCTTTGGCTCTG

Full Affymetrix probeset data:

Annotations for 1635929_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720