Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635930_at:

>probe:Drosophila_2:1635930_at:123:565; Interrogation_Position=1780; Antisense; GGCAATGAAGAACTCCCACGCGAAC
>probe:Drosophila_2:1635930_at:464:297; Interrogation_Position=1798; Antisense; CGCGAACGTCTACCAAGAATCCTAT
>probe:Drosophila_2:1635930_at:336:255; Interrogation_Position=1856; Antisense; CAAACGGAGGGCTATACGGACTGCA
>probe:Drosophila_2:1635930_at:219:557; Interrogation_Position=1873; Antisense; GGACTGCAGCTATGTATATGACCAC
>probe:Drosophila_2:1635930_at:444:687; Interrogation_Position=1887; Antisense; TATATGACCACAGTGCGTCTTCTTC
>probe:Drosophila_2:1635930_at:585:497; Interrogation_Position=1903; Antisense; GTCTTCTTCCTACGCGGATTACAAT
>probe:Drosophila_2:1635930_at:634:567; Interrogation_Position=1981; Antisense; GGCACCTACTGGTCAAGAACTTCCA
>probe:Drosophila_2:1635930_at:207:177; Interrogation_Position=2018; Antisense; AAACTCCGGGCAATCAGCTCGAATC
>probe:Drosophila_2:1635930_at:33:367; Interrogation_Position=2038; Antisense; GAATCGCAAGGAACGCACAGCATTT
>probe:Drosophila_2:1635930_at:257:379; Interrogation_Position=2087; Antisense; GAAGCGGAGTTCTGCTATTCCAACT
>probe:Drosophila_2:1635930_at:349:9; Interrogation_Position=2103; Antisense; ATTCCAACTATTTGACTCGCTTGCG
>probe:Drosophila_2:1635930_at:580:341; Interrogation_Position=2121; Antisense; GCTTGCGTCGCTACGAAATCGCAGT
>probe:Drosophila_2:1635930_at:292:587; Interrogation_Position=2151; Antisense; TGGAGCTGACCGAACGCCAGGTGAA
>probe:Drosophila_2:1635930_at:292:117; Interrogation_Position=2237; Antisense; AGCTCGGCCAAAACGCCATTTTAGT

Paste this into a BLAST search page for me
GGCAATGAAGAACTCCCACGCGAACCGCGAACGTCTACCAAGAATCCTATCAAACGGAGGGCTATACGGACTGCAGGACTGCAGCTATGTATATGACCACTATATGACCACAGTGCGTCTTCTTCGTCTTCTTCCTACGCGGATTACAATGGCACCTACTGGTCAAGAACTTCCAAAACTCCGGGCAATCAGCTCGAATCGAATCGCAAGGAACGCACAGCATTTGAAGCGGAGTTCTGCTATTCCAACTATTCCAACTATTTGACTCGCTTGCGGCTTGCGTCGCTACGAAATCGCAGTTGGAGCTGACCGAACGCCAGGTGAAAGCTCGGCCAAAACGCCATTTTAGT

Full Affymetrix probeset data:

Annotations for 1635930_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime