Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635931_at:

>probe:Drosophila_2:1635931_at:217:517; Interrogation_Position=246; Antisense; GTGTGGGCACCAACTTCAGTGAAAT
>probe:Drosophila_2:1635931_at:313:557; Interrogation_Position=283; Antisense; GGACGTCAACAAGGCCATTGCGATT
>probe:Drosophila_2:1635931_at:575:5; Interrogation_Position=299; Antisense; ATTGCGATTCCCAGCTACAAGAAGG
>probe:Drosophila_2:1635931_at:537:629; Interrogation_Position=330; Antisense; TCCTAGCGGCCCGAGTTGTGAATGG
>probe:Drosophila_2:1635931_at:65:57; Interrogation_Position=381; Antisense; ATGAGCGGCGTGTATTGGGCCTCAA
>probe:Drosophila_2:1635931_at:295:727; Interrogation_Position=395; Antisense; TTGGGCCTCAAGAAACCAGTCGTAG
>probe:Drosophila_2:1635931_at:262:675; Interrogation_Position=456; Antisense; TAGAACAACTGGCTAGCGAGCGAGC
>probe:Drosophila_2:1635931_at:154:123; Interrogation_Position=474; Antisense; AGCGAGCCGACCCAGAGTTCAGATT
>probe:Drosophila_2:1635931_at:190:265; Interrogation_Position=486; Antisense; CAGAGTTCAGATTACCCAAGGGCGT
>probe:Drosophila_2:1635931_at:282:573; Interrogation_Position=506; Antisense; GGCGTGGTCAAGGAACTGTCCTACT
>probe:Drosophila_2:1635931_at:225:161; Interrogation_Position=555; Antisense; ACAAGGCGATGGTTGCCGATCGGAA
>probe:Drosophila_2:1635931_at:365:461; Interrogation_Position=627; Antisense; GATTTATGTCGATTCCGGAGCAGTT
>probe:Drosophila_2:1635931_at:614:419; Interrogation_Position=644; Antisense; GAGCAGTTTAACGTTTACCTGGAGC
>probe:Drosophila_2:1635931_at:543:673; Interrogation_Position=677; Antisense; TTGCCCGTGGGCGTGAAACCGGACT

Paste this into a BLAST search page for me
GTGTGGGCACCAACTTCAGTGAAATGGACGTCAACAAGGCCATTGCGATTATTGCGATTCCCAGCTACAAGAAGGTCCTAGCGGCCCGAGTTGTGAATGGATGAGCGGCGTGTATTGGGCCTCAATTGGGCCTCAAGAAACCAGTCGTAGTAGAACAACTGGCTAGCGAGCGAGCAGCGAGCCGACCCAGAGTTCAGATTCAGAGTTCAGATTACCCAAGGGCGTGGCGTGGTCAAGGAACTGTCCTACTACAAGGCGATGGTTGCCGATCGGAAGATTTATGTCGATTCCGGAGCAGTTGAGCAGTTTAACGTTTACCTGGAGCTTGCCCGTGGGCGTGAAACCGGACT

Full Affymetrix probeset data:

Annotations for 1635931_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime