FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635932_at:

>probe:Drosophila_2:1635932_at:327:363; Interrogation_Position=269; Antisense; GAATTCGTAAGTAGAGTGGTGCACC
>probe:Drosophila_2:1635932_at:121:293; Interrogation_Position=274; Antisense; CGTAAGTAGAGTGGTGCACCGGCAA
>probe:Drosophila_2:1635932_at:46:535; Interrogation_Position=286; Antisense; GGTGCACCGGCAAGGAACATGACTA
>probe:Drosophila_2:1635932_at:578:353; Interrogation_Position=289; Antisense; GCACCGGCAAGGAACATGACTAAGT
>probe:Drosophila_2:1635932_at:414:561; Interrogation_Position=299; Antisense; GGAACATGACTAAGTTTTTCGCACT
>probe:Drosophila_2:1635932_at:190:611; Interrogation_Position=305; Antisense; TGACTAAGTTTTTCGCACTTGGATG
>probe:Drosophila_2:1635932_at:680:475; Interrogation_Position=312; Antisense; GTTTTTCGCACTTGGATGTTCAGGA
>probe:Drosophila_2:1635932_at:517:297; Interrogation_Position=318; Antisense; CGCACTTGGATGTTCAGGATCTCAA
>probe:Drosophila_2:1635932_at:53:547; Interrogation_Position=325; Antisense; GGATGTTCAGGATCTCAAGTCGAAG
>probe:Drosophila_2:1635932_at:33:331; Interrogation_Position=492; Antisense; GCGGCAACGAAAGCAGTAAGTTCAG
>probe:Drosophila_2:1635932_at:160:171; Interrogation_Position=501; Antisense; AAAGCAGTAAGTTCAGTGGTCGGTT
>probe:Drosophila_2:1635932_at:264:257; Interrogation_Position=505; Antisense; CAGTAAGTTCAGTGGTCGGTTGATC
>probe:Drosophila_2:1635932_at:43:713; Interrogation_Position=512; Antisense; TTCAGTGGTCGGTTGATCTGTGATA
>probe:Drosophila_2:1635932_at:30:537; Interrogation_Position=518; Antisense; GGTCGGTTGATCTGTGATATATATT

Paste this into a BLAST search page for me
GAATTCGTAAGTAGAGTGGTGCACCCGTAAGTAGAGTGGTGCACCGGCAAGGTGCACCGGCAAGGAACATGACTAGCACCGGCAAGGAACATGACTAAGTGGAACATGACTAAGTTTTTCGCACTTGACTAAGTTTTTCGCACTTGGATGGTTTTTCGCACTTGGATGTTCAGGACGCACTTGGATGTTCAGGATCTCAAGGATGTTCAGGATCTCAAGTCGAAGGCGGCAACGAAAGCAGTAAGTTCAGAAAGCAGTAAGTTCAGTGGTCGGTTCAGTAAGTTCAGTGGTCGGTTGATCTTCAGTGGTCGGTTGATCTGTGATAGGTCGGTTGATCTGTGATATATATT

Full Affymetrix probeset data:

Annotations for 1635932_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720