Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635933_at:

>probe:Drosophila_2:1635933_at:380:267; Interrogation_Position=1667; Antisense; CAGGATCAGCTGAGTAGCCGCAAGT
>probe:Drosophila_2:1635933_at:1:125; Interrogation_Position=1682; Antisense; AGCCGCAAGTCGTCCATTTACGAGA
>probe:Drosophila_2:1635933_at:502:433; Interrogation_Position=1705; Antisense; GAGTGACGACGATGGCGACAGTTCT
>probe:Drosophila_2:1635933_at:204:401; Interrogation_Position=1721; Antisense; GACAGTTCTGTGGAAGATTGCCTAG
>probe:Drosophila_2:1635933_at:190:9; Interrogation_Position=1737; Antisense; ATTGCCTAGAGTGCTGCGAGTGTCA
>probe:Drosophila_2:1635933_at:482:325; Interrogation_Position=1752; Antisense; GCGAGTGTCAGCAACGATTCACCGA
>probe:Drosophila_2:1635933_at:80:199; Interrogation_Position=1764; Antisense; AACGATTCACCGAGTTGGATGCTTA
>probe:Drosophila_2:1635933_at:102:589; Interrogation_Position=1779; Antisense; TGGATGCTTATACGGCCCATCTTAA
>probe:Drosophila_2:1635933_at:346:577; Interrogation_Position=1792; Antisense; GGCCCATCTTAAAAAGCACGACTTG
>probe:Drosophila_2:1635933_at:486:101; Interrogation_Position=1806; Antisense; AGCACGACTTGGAGTTGTACGGGAT
>probe:Drosophila_2:1635933_at:237:385; Interrogation_Position=1882; Antisense; GAAAATGTTTTGAGCCCACAATTAA
>probe:Drosophila_2:1635933_at:692:695; Interrogation_Position=1909; Antisense; TTAACTGCGCGAGAGTTGTAAACTC
>probe:Drosophila_2:1635933_at:284:465; Interrogation_Position=1923; Antisense; GTTGTAAACTCTTGGTCATTCTTTT
>probe:Drosophila_2:1635933_at:67:493; Interrogation_Position=2121; Antisense; GTAACGTGCGCCATAATCCAAGAAC

Paste this into a BLAST search page for me
CAGGATCAGCTGAGTAGCCGCAAGTAGCCGCAAGTCGTCCATTTACGAGAGAGTGACGACGATGGCGACAGTTCTGACAGTTCTGTGGAAGATTGCCTAGATTGCCTAGAGTGCTGCGAGTGTCAGCGAGTGTCAGCAACGATTCACCGAAACGATTCACCGAGTTGGATGCTTATGGATGCTTATACGGCCCATCTTAAGGCCCATCTTAAAAAGCACGACTTGAGCACGACTTGGAGTTGTACGGGATGAAAATGTTTTGAGCCCACAATTAATTAACTGCGCGAGAGTTGTAAACTCGTTGTAAACTCTTGGTCATTCTTTTGTAACGTGCGCCATAATCCAAGAAC

Full Affymetrix probeset data:

Annotations for 1635933_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime