Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635934_at:

>probe:Drosophila_2:1635934_at:324:123; Interrogation_Position=1265; Antisense; AGCCCAGAAGTCAATACCGTGCAAA
>probe:Drosophila_2:1635934_at:367:421; Interrogation_Position=1312; Antisense; GAGCAACAACGCAATGTCACCCAGT
>probe:Drosophila_2:1635934_at:154:133; Interrogation_Position=1330; Antisense; ACCCAGTCCAATAGAGCGCTTCTTA
>probe:Drosophila_2:1635934_at:401:155; Interrogation_Position=1373; Antisense; ACAGCACAGTTCCATGTGACCTGGA
>probe:Drosophila_2:1635934_at:354:87; Interrogation_Position=1434; Antisense; AGTCCATTGAAGTCCCGAATCTGTG
>probe:Drosophila_2:1635934_at:469:593; Interrogation_Position=1467; Antisense; TGGGAGCAGGCTTCGATTCGGACAC
>probe:Drosophila_2:1635934_at:3:261; Interrogation_Position=1513; Antisense; CATCCACGACTTCTTTGTACCAAAT
>probe:Drosophila_2:1635934_at:332:225; Interrogation_Position=1538; Antisense; AAGGAGCCAAACACAGCAGCTGTCT
>probe:Drosophila_2:1635934_at:710:363; Interrogation_Position=1586; Antisense; GAATTCACCATTTTGGCCATGCTCA
>probe:Drosophila_2:1635934_at:657:313; Interrogation_Position=1601; Antisense; GCCATGCTCATGTCCGCAGAGGAGA
>probe:Drosophila_2:1635934_at:484:387; Interrogation_Position=1627; Antisense; GAAAATGGTTTCGTCTATCCTCAAC
>probe:Drosophila_2:1635934_at:194:361; Interrogation_Position=1671; Antisense; GCAAGAATCCGGCTGTGCTGGACAA
>probe:Drosophila_2:1635934_at:121:289; Interrogation_Position=1711; Antisense; CGGAGTAGCCTAAACACCCAATGTT
>probe:Drosophila_2:1635934_at:426:457; Interrogation_Position=1827; Antisense; GATAGGATCCCAAAACGTTACACAG

Paste this into a BLAST search page for me
AGCCCAGAAGTCAATACCGTGCAAAGAGCAACAACGCAATGTCACCCAGTACCCAGTCCAATAGAGCGCTTCTTAACAGCACAGTTCCATGTGACCTGGAAGTCCATTGAAGTCCCGAATCTGTGTGGGAGCAGGCTTCGATTCGGACACCATCCACGACTTCTTTGTACCAAATAAGGAGCCAAACACAGCAGCTGTCTGAATTCACCATTTTGGCCATGCTCAGCCATGCTCATGTCCGCAGAGGAGAGAAAATGGTTTCGTCTATCCTCAACGCAAGAATCCGGCTGTGCTGGACAACGGAGTAGCCTAAACACCCAATGTTGATAGGATCCCAAAACGTTACACAG

Full Affymetrix probeset data:

Annotations for 1635934_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime