Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635935_at:

>probe:Drosophila_2:1635935_at:628:161; Interrogation_Position=13; Antisense; AAATTCCGCTTCTGTGGCGAAGGCG
>probe:Drosophila_2:1635935_at:303:235; Interrogation_Position=167; Antisense; AATCGCTGACATCCACATTAACTAA
>probe:Drosophila_2:1635935_at:723:131; Interrogation_Position=202; Antisense; ACCGCCGTGGCATGCATCAATTTTA
>probe:Drosophila_2:1635935_at:337:245; Interrogation_Position=220; Antisense; AATTTTATGCTGACCAGCGCAGCTC
>probe:Drosophila_2:1635935_at:412:427; Interrogation_Position=277; Antisense; GAGATCCAGCAATTGGGACTTCCCA
>probe:Drosophila_2:1635935_at:13:127; Interrogation_Position=315; Antisense; AGCCATGTGCAGAGTCCTCCAAAAG
>probe:Drosophila_2:1635935_at:327:207; Interrogation_Position=337; Antisense; AAGCATTCCGCCACCATAAGGCAAA
>probe:Drosophila_2:1635935_at:32:385; Interrogation_Position=391; Antisense; GAACTGACAAGCGTCCGAGACATAT
>probe:Drosophila_2:1635935_at:52:425; Interrogation_Position=407; Antisense; GAGACATATCTACGCCAGGGCAAAC
>probe:Drosophila_2:1635935_at:279:177; Interrogation_Position=438; Antisense; AAACTACGCCACCTTGGAACTGAAG
>probe:Drosophila_2:1635935_at:80:305; Interrogation_Position=44; Antisense; CCGATTGGGTCCTAGCTGAGATCAT
>probe:Drosophila_2:1635935_at:480:211; Interrogation_Position=470; Antisense; AAGAACTGGTCGATGGCCTACCGAA
>probe:Drosophila_2:1635935_at:292:451; Interrogation_Position=520; Antisense; GATCGCACCCAAATGAAGGCTCTGC
>probe:Drosophila_2:1635935_at:524:453; Interrogation_Position=63; Antisense; GATCATATCAACACTCTCGAACTTG

Paste this into a BLAST search page for me
AAATTCCGCTTCTGTGGCGAAGGCGAATCGCTGACATCCACATTAACTAAACCGCCGTGGCATGCATCAATTTTAAATTTTATGCTGACCAGCGCAGCTCGAGATCCAGCAATTGGGACTTCCCAAGCCATGTGCAGAGTCCTCCAAAAGAAGCATTCCGCCACCATAAGGCAAAGAACTGACAAGCGTCCGAGACATATGAGACATATCTACGCCAGGGCAAACAAACTACGCCACCTTGGAACTGAAGCCGATTGGGTCCTAGCTGAGATCATAAGAACTGGTCGATGGCCTACCGAAGATCGCACCCAAATGAAGGCTCTGCGATCATATCAACACTCTCGAACTTG

Full Affymetrix probeset data:

Annotations for 1635935_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime