FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635936_at:

>probe:Drosophila_2:1635936_at:415:47; Interrogation_Position=206; Antisense; ATCCGGCGCAGATTGTACGATGCTC
>probe:Drosophila_2:1635936_at:300:501; Interrogation_Position=250; Antisense; GTCGGTCACCGATCTAAAGCTATAT
>probe:Drosophila_2:1635936_at:212:529; Interrogation_Position=290; Antisense; GGGTTCTACAACAACACATCCACTG
>probe:Drosophila_2:1635936_at:249:271; Interrogation_Position=371; Antisense; CATGCCTGCATTATTGAGACCCTGG
>probe:Drosophila_2:1635936_at:690:101; Interrogation_Position=387; Antisense; AGACCCTGGACATTCGGAAGGCCTT
>probe:Drosophila_2:1635936_at:617:651; Interrogation_Position=411; Antisense; TCAATCTGATCTACTGCATGCTGCG
>probe:Drosophila_2:1635936_at:478:269; Interrogation_Position=427; Antisense; CATGCTGCGCTCCTATTCGAATGAG
>probe:Drosophila_2:1635936_at:451:433; Interrogation_Position=500; Antisense; GAGTGTAAGGCATCCCGAACCACGG
>probe:Drosophila_2:1635936_at:373:241; Interrogation_Position=529; Antisense; AATACTGGCGCCCTACGGCAAGGAA
>probe:Drosophila_2:1635936_at:464:271; Interrogation_Position=557; Antisense; CTTAAACTGGGCATCTCCTTTGTGC
>probe:Drosophila_2:1635936_at:705:727; Interrogation_Position=576; Antisense; TTGTGCCCACCATTGTGTTCGAGAA
>probe:Drosophila_2:1635936_at:77:57; Interrogation_Position=600; Antisense; ATGACTTTGATCCTTACGACCAGAG
>probe:Drosophila_2:1635936_at:610:105; Interrogation_Position=647; Antisense; AGACACTTCTGTCGGCAGTATCTGA
>probe:Drosophila_2:1635936_at:499:625; Interrogation_Position=690; Antisense; TGCCCACTTGTTCCGCAATTTTGTA

Paste this into a BLAST search page for me
ATCCGGCGCAGATTGTACGATGCTCGTCGGTCACCGATCTAAAGCTATATGGGTTCTACAACAACACATCCACTGCATGCCTGCATTATTGAGACCCTGGAGACCCTGGACATTCGGAAGGCCTTTCAATCTGATCTACTGCATGCTGCGCATGCTGCGCTCCTATTCGAATGAGGAGTGTAAGGCATCCCGAACCACGGAATACTGGCGCCCTACGGCAAGGAACTTAAACTGGGCATCTCCTTTGTGCTTGTGCCCACCATTGTGTTCGAGAAATGACTTTGATCCTTACGACCAGAGAGACACTTCTGTCGGCAGTATCTGATGCCCACTTGTTCCGCAATTTTGTA

Full Affymetrix probeset data:

Annotations for 1635936_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720