FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635937_at:

>probe:Drosophila_2:1635937_at:446:181; Interrogation_Position=1619; Antisense; AAAAAGGAGCTTCCCTGCGTGAGCA
>probe:Drosophila_2:1635937_at:292:361; Interrogation_Position=1641; Antisense; GCAATGTGCTACTTATCGGCGATCA
>probe:Drosophila_2:1635937_at:109:37; Interrogation_Position=1662; Antisense; ATCATCGAAAGTATCTCACCGTCCT
>probe:Drosophila_2:1635937_at:408:363; Interrogation_Position=1722; Antisense; GAATTCCACTGGATGCTCTGCGTGA
>probe:Drosophila_2:1635937_at:511:233; Interrogation_Position=1753; Antisense; AATCGAATGGCTGCGGGACCTGGAT
>probe:Drosophila_2:1635937_at:125:131; Interrogation_Position=1770; Antisense; ACCTGGATATCCATGAGACCCGTCT
>probe:Drosophila_2:1635937_at:637:337; Interrogation_Position=1847; Antisense; GCTCTGGCAGCTACCTTGGAGATCA
>probe:Drosophila_2:1635937_at:621:173; Interrogation_Position=1877; Antisense; AAACCTAAGCTCCTGGAAGCCATCG
>probe:Drosophila_2:1635937_at:5:185; Interrogation_Position=1956; Antisense; AAAAGTTTGCCCTCATTGCTCATGA
>probe:Drosophila_2:1635937_at:161:7; Interrogation_Position=1970; Antisense; ATTGCTCATGAGTTTTCCGTGGCCA
>probe:Drosophila_2:1635937_at:157:121; Interrogation_Position=2001; Antisense; AGCTGGGTCCCACGCTGAAAATCAG
>probe:Drosophila_2:1635937_at:521:3; Interrogation_Position=2033; Antisense; ATTGTCCACGCCAAATATGCCAAAG
>probe:Drosophila_2:1635937_at:92:89; Interrogation_Position=2056; Antisense; AGTCATCGAGCGTCTGTACAAGTAA
>probe:Drosophila_2:1635937_at:488:15; Interrogation_Position=2124; Antisense; ATTTTACTCGATCGCTTACATTGTA

Paste this into a BLAST search page for me
AAAAAGGAGCTTCCCTGCGTGAGCAGCAATGTGCTACTTATCGGCGATCAATCATCGAAAGTATCTCACCGTCCTGAATTCCACTGGATGCTCTGCGTGAAATCGAATGGCTGCGGGACCTGGATACCTGGATATCCATGAGACCCGTCTGCTCTGGCAGCTACCTTGGAGATCAAAACCTAAGCTCCTGGAAGCCATCGAAAAGTTTGCCCTCATTGCTCATGAATTGCTCATGAGTTTTCCGTGGCCAAGCTGGGTCCCACGCTGAAAATCAGATTGTCCACGCCAAATATGCCAAAGAGTCATCGAGCGTCTGTACAAGTAAATTTTACTCGATCGCTTACATTGTA

Full Affymetrix probeset data:

Annotations for 1635937_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720