FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635940_at:

>probe:Drosophila_2:1635940_at:470:483; Interrogation_Position=438; Antisense; GTATAATCAACTTTCCTGCGGTTCC
>probe:Drosophila_2:1635940_at:26:649; Interrogation_Position=491; Antisense; TCATGGGTCAGGTATTCAAGCGAAC
>probe:Drosophila_2:1635940_at:681:405; Interrogation_Position=553; Antisense; GACTGCAGTGTGTCCCATGGAAACC
>probe:Drosophila_2:1635940_at:186:387; Interrogation_Position=572; Antisense; GAAACCAAGGATGCGTCGGCGGCTC
>probe:Drosophila_2:1635940_at:383:331; Interrogation_Position=590; Antisense; GCGGCTCCCTGCGAAATACTTTGAG
>probe:Drosophila_2:1635940_at:59:477; Interrogation_Position=614; Antisense; GTTATTTGCAGAGCACGGGCGGCAT
>probe:Drosophila_2:1635940_at:50:227; Interrogation_Position=674; Antisense; AAGGCAAATGCCAGTTCGTACCCGA
>probe:Drosophila_2:1635940_at:136:487; Interrogation_Position=691; Antisense; GTACCCGATTTATCCGTAGTTAATG
>probe:Drosophila_2:1635940_at:195:657; Interrogation_Position=711; Antisense; TAATGTGACATCCTGGGCCATTCTT
>probe:Drosophila_2:1635940_at:256:349; Interrogation_Position=766; Antisense; GCAGTTACCCACATTGGACCAGTTG
>probe:Drosophila_2:1635940_at:270:361; Interrogation_Position=790; Antisense; GCAATTTCTATAAATGCCTCCCCAA
>probe:Drosophila_2:1635940_at:9:195; Interrogation_Position=824; Antisense; AACTGTACAGTGACGGCATCTACGA
>probe:Drosophila_2:1635940_at:244:343; Interrogation_Position=868; Antisense; GCTTCCGTAAATCATGCCATGGTGG
>probe:Drosophila_2:1635940_at:435:565; Interrogation_Position=994; Antisense; GGAATTGCCAATTATGCCGCTTATG

Paste this into a BLAST search page for me
GTATAATCAACTTTCCTGCGGTTCCTCATGGGTCAGGTATTCAAGCGAACGACTGCAGTGTGTCCCATGGAAACCGAAACCAAGGATGCGTCGGCGGCTCGCGGCTCCCTGCGAAATACTTTGAGGTTATTTGCAGAGCACGGGCGGCATAAGGCAAATGCCAGTTCGTACCCGAGTACCCGATTTATCCGTAGTTAATGTAATGTGACATCCTGGGCCATTCTTGCAGTTACCCACATTGGACCAGTTGGCAATTTCTATAAATGCCTCCCCAAAACTGTACAGTGACGGCATCTACGAGCTTCCGTAAATCATGCCATGGTGGGGAATTGCCAATTATGCCGCTTATG

Full Affymetrix probeset data:

Annotations for 1635940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720