Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635944_a_at:

>probe:Drosophila_2:1635944_a_at:13:157; Interrogation_Position=111; Antisense; ACAGCAGTATTCTACAGGCACATTG
>probe:Drosophila_2:1635944_a_at:104:73; Interrogation_Position=126; Antisense; AGGCACATTGTCAAGCAAATTCACA
>probe:Drosophila_2:1635944_a_at:411:649; Interrogation_Position=146; Antisense; TCACAATGGAGAACAACGAAGCCCC
>probe:Drosophila_2:1635944_a_at:163:387; Interrogation_Position=267; Antisense; GAACAACAATGCAGCCCAGAAGAAG
>probe:Drosophila_2:1635944_a_at:167:353; Interrogation_Position=294; Antisense; GCAGCAGACCCAAGCCAAGGTGGAC
>probe:Drosophila_2:1635944_a_at:494:119; Interrogation_Position=362; Antisense; AGCGGGACCAGAAGCTATCGGAACT
>probe:Drosophila_2:1635944_a_at:491:119; Interrogation_Position=404; Antisense; AGCTGGAGCAGGGAGCATCCCAGTT
>probe:Drosophila_2:1635944_a_at:209:553; Interrogation_Position=415; Antisense; GGAGCATCCCAGTTCGAGCAGCAGG
>probe:Drosophila_2:1635944_a_at:456:379; Interrogation_Position=450; Antisense; GAAGCGCAAGCAATGGTGGGCCAAC
>probe:Drosophila_2:1635944_a_at:577:35; Interrogation_Position=487; Antisense; ATCATTCTGGGCGTGATAGCCGTTG
>probe:Drosophila_2:1635944_a_at:162:675; Interrogation_Position=503; Antisense; TAGCCGTTGTGCTGCTCATCATCGT
>probe:Drosophila_2:1635944_a_at:252:621; Interrogation_Position=512; Antisense; TGCTGCTCATCATCGTTCTGGTGTC
>probe:Drosophila_2:1635944_a_at:79:173; Interrogation_Position=74; Antisense; AAAGCAGCCGCAGTTTTCCGTGGAA
>probe:Drosophila_2:1635944_a_at:283:561; Interrogation_Position=95; Antisense; GGAAAACCCGAAATACACAGCAGTA

Paste this into a BLAST search page for me
ACAGCAGTATTCTACAGGCACATTGAGGCACATTGTCAAGCAAATTCACATCACAATGGAGAACAACGAAGCCCCGAACAACAATGCAGCCCAGAAGAAGGCAGCAGACCCAAGCCAAGGTGGACAGCGGGACCAGAAGCTATCGGAACTAGCTGGAGCAGGGAGCATCCCAGTTGGAGCATCCCAGTTCGAGCAGCAGGGAAGCGCAAGCAATGGTGGGCCAACATCATTCTGGGCGTGATAGCCGTTGTAGCCGTTGTGCTGCTCATCATCGTTGCTGCTCATCATCGTTCTGGTGTCAAAGCAGCCGCAGTTTTCCGTGGAAGGAAAACCCGAAATACACAGCAGTA

Full Affymetrix probeset data:

Annotations for 1635944_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime