FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635945_at:

>probe:Drosophila_2:1635945_at:660:231; Interrogation_Position=133; Antisense; AATGAACACTCATCGCAGTCCAGAG
>probe:Drosophila_2:1635945_at:534:167; Interrogation_Position=172; Antisense; AAATGCACTGACTTCCAGCTGGACA
>probe:Drosophila_2:1635945_at:399:585; Interrogation_Position=191; Antisense; TGGACAACGCTTCTGGCAATGCTCG
>probe:Drosophila_2:1635945_at:703:361; Interrogation_Position=206; Antisense; GCAATGCTCGTCTGATCTTCATCAG
>probe:Drosophila_2:1635945_at:568:519; Interrogation_Position=241; Antisense; GTGGATGATCCTCTACAGAGCCTAA
>probe:Drosophila_2:1635945_at:564:567; Interrogation_Position=270; Antisense; GGCACTACTTGAGGAGCTGAATCTT
>probe:Drosophila_2:1635945_at:251:365; Interrogation_Position=288; Antisense; GAATCTTCCGGAACTTGTGGTCAGC
>probe:Drosophila_2:1635945_at:66:201; Interrogation_Position=337; Antisense; AACCGCTTAGTTTTTGAGCTGCCAA
>probe:Drosophila_2:1635945_at:290:51; Interrogation_Position=371; Antisense; ATGCCCTCTTCACTCTGAATAGTTT
>probe:Drosophila_2:1635945_at:266:243; Interrogation_Position=388; Antisense; AATAGTTTCTGCAATCGGTATCGCG
>probe:Drosophila_2:1635945_at:283:43; Interrogation_Position=413; Antisense; ATCGTCACGATCTCACCTATGAAAT
>probe:Drosophila_2:1635945_at:305:365; Interrogation_Position=45; Antisense; GAATCCCAGGGCAAAGACCTCGTAC
>probe:Drosophila_2:1635945_at:378:393; Interrogation_Position=70; Antisense; GTAAATGACTTTGTATTCCCCACCG
>probe:Drosophila_2:1635945_at:160:215; Interrogation_Position=95; Antisense; AAGATGAGCAAGTCATTCGCCCCTG

Paste this into a BLAST search page for me
AATGAACACTCATCGCAGTCCAGAGAAATGCACTGACTTCCAGCTGGACATGGACAACGCTTCTGGCAATGCTCGGCAATGCTCGTCTGATCTTCATCAGGTGGATGATCCTCTACAGAGCCTAAGGCACTACTTGAGGAGCTGAATCTTGAATCTTCCGGAACTTGTGGTCAGCAACCGCTTAGTTTTTGAGCTGCCAAATGCCCTCTTCACTCTGAATAGTTTAATAGTTTCTGCAATCGGTATCGCGATCGTCACGATCTCACCTATGAAATGAATCCCAGGGCAAAGACCTCGTACGTAAATGACTTTGTATTCCCCACCGAAGATGAGCAAGTCATTCGCCCCTG

Full Affymetrix probeset data:

Annotations for 1635945_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720