FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635947_at:

>probe:Drosophila_2:1635947_at:85:203; Interrogation_Position=130; Antisense; AACCTGTCGAGAGCTGTTGTCCGTA
>probe:Drosophila_2:1635947_at:677:447; Interrogation_Position=284; Antisense; GATCCGTCGTGGACAACGTGCTCTA
>probe:Drosophila_2:1635947_at:349:271; Interrogation_Position=339; Antisense; CATCGGTGGCATGGGCAAGCTTTTC
>probe:Drosophila_2:1635947_at:2:697; Interrogation_Position=360; Antisense; TTTCTACGAGCTGAGTGTTCCCAAG
>probe:Drosophila_2:1635947_at:628:431; Interrogation_Position=388; Antisense; GAGTGAAGTCGCAGTACCGAACCCT
>probe:Drosophila_2:1635947_at:24:497; Interrogation_Position=39; Antisense; GTCAGCTGTCATATTTCAGACCGAT
>probe:Drosophila_2:1635947_at:120:673; Interrogation_Position=402; Antisense; TACCGAACCCTAAGCTAAGCCATTA
>probe:Drosophila_2:1635947_at:154:659; Interrogation_Position=417; Antisense; TAAGCCATTAAACCCCGCGCAAGAT
>probe:Drosophila_2:1635947_at:367:95; Interrogation_Position=438; Antisense; AGATCCGTGATTCAGCGTAGTCGCC
>probe:Drosophila_2:1635947_at:478:291; Interrogation_Position=453; Antisense; CGTAGTCGCCTTATATTTCAATGTT
>probe:Drosophila_2:1635947_at:421:231; Interrogation_Position=472; Antisense; AATGTTTTGATTGTAGCCTTGCCCT
>probe:Drosophila_2:1635947_at:72:723; Interrogation_Position=490; Antisense; TTGCCCTGGATACCTGGACAACATG
>probe:Drosophila_2:1635947_at:309:263; Interrogation_Position=55; Antisense; CAGACCGATATTTTTCGCCCAGGAA
>probe:Drosophila_2:1635947_at:349:559; Interrogation_Position=76; Antisense; GGAAAACTGCTCACTTTTTGCTAAA

Paste this into a BLAST search page for me
AACCTGTCGAGAGCTGTTGTCCGTAGATCCGTCGTGGACAACGTGCTCTACATCGGTGGCATGGGCAAGCTTTTCTTTCTACGAGCTGAGTGTTCCCAAGGAGTGAAGTCGCAGTACCGAACCCTGTCAGCTGTCATATTTCAGACCGATTACCGAACCCTAAGCTAAGCCATTATAAGCCATTAAACCCCGCGCAAGATAGATCCGTGATTCAGCGTAGTCGCCCGTAGTCGCCTTATATTTCAATGTTAATGTTTTGATTGTAGCCTTGCCCTTTGCCCTGGATACCTGGACAACATGCAGACCGATATTTTTCGCCCAGGAAGGAAAACTGCTCACTTTTTGCTAAA

Full Affymetrix probeset data:

Annotations for 1635947_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720