FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635950_at:

>probe:Drosophila_2:1635950_at:509:605; Interrogation_Position=1003; Antisense; TGATGGTTTACTGTGGTGCCACCGC
>probe:Drosophila_2:1635950_at:59:675; Interrogation_Position=1039; Antisense; TAGCCAAGATGCTGAAGCGCCGTCA
>probe:Drosophila_2:1635950_at:709:79; Interrogation_Position=1083; Antisense; AGGTCGCACATGTACGATGCCCTTG
>probe:Drosophila_2:1635950_at:149:217; Interrogation_Position=1166; Antisense; AAGTCTGGCTGATCTATCGGTTTTC
>probe:Drosophila_2:1635950_at:682:639; Interrogation_Position=1182; Antisense; TCGGTTTTCGGCGTGCTTTCAAGCA
>probe:Drosophila_2:1635950_at:63:729; Interrogation_Position=1232; Antisense; TTGTCTGCAAAACACCAGCATCGGT
>probe:Drosophila_2:1635950_at:392:381; Interrogation_Position=1314; Antisense; GAACGTATTGAAAACATGGCCGCTA
>probe:Drosophila_2:1635950_at:205:297; Interrogation_Position=875; Antisense; CGACAGCCACTTGGTGCATCTAATA
>probe:Drosophila_2:1635950_at:366:619; Interrogation_Position=889; Antisense; TGCATCTAATATCGCCCAACTGTTA
>probe:Drosophila_2:1635950_at:212:195; Interrogation_Position=906; Antisense; AACTGTTATCAGACCATGGGCGAGT
>probe:Drosophila_2:1635950_at:402:63; Interrogation_Position=921; Antisense; ATGGGCGAGTCCCTAGAGACTTTTG
>probe:Drosophila_2:1635950_at:396:403; Interrogation_Position=938; Antisense; GACTTTTGAGTGGTTCTCGCAAGCT
>probe:Drosophila_2:1635950_at:670:429; Interrogation_Position=966; Antisense; GAGTGGGACGTTCACTTCCCCAAAT
>probe:Drosophila_2:1635950_at:73:169; Interrogation_Position=987; Antisense; AAATGGGAGCGCGACCTGATGGTTT

Paste this into a BLAST search page for me
TGATGGTTTACTGTGGTGCCACCGCTAGCCAAGATGCTGAAGCGCCGTCAAGGTCGCACATGTACGATGCCCTTGAAGTCTGGCTGATCTATCGGTTTTCTCGGTTTTCGGCGTGCTTTCAAGCATTGTCTGCAAAACACCAGCATCGGTGAACGTATTGAAAACATGGCCGCTACGACAGCCACTTGGTGCATCTAATATGCATCTAATATCGCCCAACTGTTAAACTGTTATCAGACCATGGGCGAGTATGGGCGAGTCCCTAGAGACTTTTGGACTTTTGAGTGGTTCTCGCAAGCTGAGTGGGACGTTCACTTCCCCAAATAAATGGGAGCGCGACCTGATGGTTT

Full Affymetrix probeset data:

Annotations for 1635950_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720