Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635951_at:

>probe:Drosophila_2:1635951_at:332:605; Interrogation_Position=2118; Antisense; TGCAGGAAAGCGGACGAAGAACGAA
>probe:Drosophila_2:1635951_at:616:219; Interrogation_Position=2248; Antisense; AAGTGGCCAAACTGGAAGCTGCTGA
>probe:Drosophila_2:1635951_at:229:287; Interrogation_Position=2259; Antisense; CTGGAAGCTGCTGAGAAGGCCAAGC
>probe:Drosophila_2:1635951_at:471:309; Interrogation_Position=2278; Antisense; CCAAGCGTTTGAAGGAGGAAGAGAA
>probe:Drosophila_2:1635951_at:210:107; Interrogation_Position=2312; Antisense; AGAACTAATGAAGTGCAAGCAACGA
>probe:Drosophila_2:1635951_at:284:199; Interrogation_Position=2393; Antisense; AAGGGAGCTAGCTGAAATGGAAAAC
>probe:Drosophila_2:1635951_at:111:133; Interrogation_Position=2416; Antisense; ACAAATGGAAACAGGTTGCGGAGAA
>probe:Drosophila_2:1635951_at:484:237; Interrogation_Position=2509; Antisense; AATCGGCTGATAAGATTCTGAAAGC
>probe:Drosophila_2:1635951_at:303:215; Interrogation_Position=2520; Antisense; AAGATTCTGAAAGCTGTGTGCGAAA
>probe:Drosophila_2:1635951_at:424:389; Interrogation_Position=2541; Antisense; GAAAAACTAAAGCAATCTCTCTCGG
>probe:Drosophila_2:1635951_at:602:661; Interrogation_Position=2548; Antisense; TAAAGCAATCTCTCTCGGATCCGGA
>probe:Drosophila_2:1635951_at:466:637; Interrogation_Position=2562; Antisense; TCGGATCCGGACAAATCAAAAAAGG
>probe:Drosophila_2:1635951_at:90:339; Interrogation_Position=2605; Antisense; GCTAATGGCAGATTTATATGGAACA
>probe:Drosophila_2:1635951_at:215:515; Interrogation_Position=2647; Antisense; GTGTTACACACCGAATTCCAAATTA

Paste this into a BLAST search page for me
TGCAGGAAAGCGGACGAAGAACGAAAAGTGGCCAAACTGGAAGCTGCTGACTGGAAGCTGCTGAGAAGGCCAAGCCCAAGCGTTTGAAGGAGGAAGAGAAAGAACTAATGAAGTGCAAGCAACGAAAGGGAGCTAGCTGAAATGGAAAACACAAATGGAAACAGGTTGCGGAGAAAATCGGCTGATAAGATTCTGAAAGCAAGATTCTGAAAGCTGTGTGCGAAAGAAAAACTAAAGCAATCTCTCTCGGTAAAGCAATCTCTCTCGGATCCGGATCGGATCCGGACAAATCAAAAAAGGGCTAATGGCAGATTTATATGGAACAGTGTTACACACCGAATTCCAAATTA

Full Affymetrix probeset data:

Annotations for 1635951_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime