FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635952_at:

>probe:Drosophila_2:1635952_at:14:309; Interrogation_Position=436; Antisense; CCAGCTGCCAAGTGAGTCCGAATTC
>probe:Drosophila_2:1635952_at:471:117; Interrogation_Position=438; Antisense; AGCTGCCAAGTGAGTCCGAATTCCA
>probe:Drosophila_2:1635952_at:134:337; Interrogation_Position=439; Antisense; GCTGCCAAGTGAGTCCGAATTCCAT
>probe:Drosophila_2:1635952_at:489:625; Interrogation_Position=441; Antisense; TGCCAAGTGAGTCCGAATTCCATCA
>probe:Drosophila_2:1635952_at:409:303; Interrogation_Position=453; Antisense; CCGAATTCCATCAACAAAATAGGAA
>probe:Drosophila_2:1635952_at:189:73; Interrogation_Position=473; Antisense; AGGAAGTATGCTAAACGTGTATGAT
>probe:Drosophila_2:1635952_at:65:485; Interrogation_Position=478; Antisense; GTATGCTAAACGTGTATGATCCTTC
>probe:Drosophila_2:1635952_at:401:53; Interrogation_Position=480; Antisense; ATGCTAAACGTGTATGATCCTTCCA
>probe:Drosophila_2:1635952_at:428:177; Interrogation_Position=485; Antisense; AAACGTGTATGATCCTTCCACTAGG
>probe:Drosophila_2:1635952_at:351:139; Interrogation_Position=487; Antisense; ACGTGTATGATCCTTCCACTAGGTG
>probe:Drosophila_2:1635952_at:479:515; Interrogation_Position=489; Antisense; GTGTATGATCCTTCCACTAGGTGAT
>probe:Drosophila_2:1635952_at:634:483; Interrogation_Position=491; Antisense; GTATGATCCTTCCACTAGGTGATGT
>probe:Drosophila_2:1635952_at:171:607; Interrogation_Position=494; Antisense; TGATCCTTCCACTAGGTGATGTCAA
>probe:Drosophila_2:1635952_at:593:45; Interrogation_Position=496; Antisense; ATCCTTCCACTAGGTGATGTCAACC

Paste this into a BLAST search page for me
CCAGCTGCCAAGTGAGTCCGAATTCAGCTGCCAAGTGAGTCCGAATTCCAGCTGCCAAGTGAGTCCGAATTCCATTGCCAAGTGAGTCCGAATTCCATCACCGAATTCCATCAACAAAATAGGAAAGGAAGTATGCTAAACGTGTATGATGTATGCTAAACGTGTATGATCCTTCATGCTAAACGTGTATGATCCTTCCAAAACGTGTATGATCCTTCCACTAGGACGTGTATGATCCTTCCACTAGGTGGTGTATGATCCTTCCACTAGGTGATGTATGATCCTTCCACTAGGTGATGTTGATCCTTCCACTAGGTGATGTCAAATCCTTCCACTAGGTGATGTCAACC

Full Affymetrix probeset data:

Annotations for 1635952_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720