FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635953_at:

>probe:Drosophila_2:1635953_at:26:287; Interrogation_Position=1048; Antisense; GCGACTTTAAAGCTTACTCAACGTT
>probe:Drosophila_2:1635953_at:718:9; Interrogation_Position=1103; Antisense; ATTCCGAGCCTTTTCAGGTCATCAA
>probe:Drosophila_2:1635953_at:112:175; Interrogation_Position=1151; Antisense; AAAGCCATTTTGACACGTCGCTTGC
>probe:Drosophila_2:1635953_at:294:677; Interrogation_Position=1209; Antisense; TAGACTCGCCACAACACTTTTTTAT
>probe:Drosophila_2:1635953_at:224:147; Interrogation_Position=1224; Antisense; ACTTTTTTATGTCAGCGGTGCCACC
>probe:Drosophila_2:1635953_at:726:693; Interrogation_Position=1252; Antisense; TTTCCGGGTCTAAATATCACTGTCT
>probe:Drosophila_2:1635953_at:557:561; Interrogation_Position=1288; Antisense; GGAACTGTTCTCATGTGGTACAATC
>probe:Drosophila_2:1635953_at:43:729; Interrogation_Position=816; Antisense; TTGTGTAACTGCTCCTTTTCTGCGA
>probe:Drosophila_2:1635953_at:436:603; Interrogation_Position=884; Antisense; TGATTCTTCTACACGACATGGTCTC
>probe:Drosophila_2:1635953_at:484:537; Interrogation_Position=903; Antisense; GGTCTCTCACAAGGAGGGTGCTCTT
>probe:Drosophila_2:1635953_at:236:531; Interrogation_Position=918; Antisense; GGGTGCTCTTATAAGATCTTCCAGT
>probe:Drosophila_2:1635953_at:550:661; Interrogation_Position=942; Antisense; TAAAAATCAGATCCTTCCTTCCGAA
>probe:Drosophila_2:1635953_at:159:633; Interrogation_Position=961; Antisense; TCCGAAACAGTCAACGCCGCAAATG
>probe:Drosophila_2:1635953_at:47:397; Interrogation_Position=991; Antisense; GAAATTGCCAAGTTCCGCACTTCAA

Paste this into a BLAST search page for me
GCGACTTTAAAGCTTACTCAACGTTATTCCGAGCCTTTTCAGGTCATCAAAAAGCCATTTTGACACGTCGCTTGCTAGACTCGCCACAACACTTTTTTATACTTTTTTATGTCAGCGGTGCCACCTTTCCGGGTCTAAATATCACTGTCTGGAACTGTTCTCATGTGGTACAATCTTGTGTAACTGCTCCTTTTCTGCGATGATTCTTCTACACGACATGGTCTCGGTCTCTCACAAGGAGGGTGCTCTTGGGTGCTCTTATAAGATCTTCCAGTTAAAAATCAGATCCTTCCTTCCGAATCCGAAACAGTCAACGCCGCAAATGGAAATTGCCAAGTTCCGCACTTCAA

Full Affymetrix probeset data:

Annotations for 1635953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720