Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635954_at:

>probe:Drosophila_2:1635954_at:269:545; Interrogation_Position=7773; Antisense; GGATCTAGATTACGCCCTCATGATG
>probe:Drosophila_2:1635954_at:35:511; Interrogation_Position=7843; Antisense; GTGCAGTTGCTCGAGGAACGTGATC
>probe:Drosophila_2:1635954_at:465:383; Interrogation_Position=7858; Antisense; GAACGTGATCACCTGCAACTGAAGT
>probe:Drosophila_2:1635954_at:634:215; Interrogation_Position=7879; Antisense; AAGTTGTCGGACACACTGCGCCAGT
>probe:Drosophila_2:1635954_at:560:195; Interrogation_Position=7908; Antisense; AACTGAGCGGAGTCGCGTTAGCGAT
>probe:Drosophila_2:1635954_at:36:123; Interrogation_Position=7927; Antisense; AGCGATGAACCAAGTGCCACGGCAT
>probe:Drosophila_2:1635954_at:273:113; Interrogation_Position=7972; Antisense; AGCAGTCCCAGTAAAATCAGCAGTG
>probe:Drosophila_2:1635954_at:415:155; Interrogation_Position=8006; Antisense; ACAGCGAACTTCTGGGCACGACGAG
>probe:Drosophila_2:1635954_at:329:263; Interrogation_Position=8033; Antisense; CAGCGGGCAGTGACCTCAAGCAGAA
>probe:Drosophila_2:1635954_at:102:339; Interrogation_Position=8070; Antisense; GCAGACGGTGAAGCATTCCAAGGAC
>probe:Drosophila_2:1635954_at:469:349; Interrogation_Position=8163; Antisense; GCAGGGCTCGGGATCACAATCAGGA
>probe:Drosophila_2:1635954_at:506:111; Interrogation_Position=8235; Antisense; AGCAATAGGCGTGGATCTCTCTCAA
>probe:Drosophila_2:1635954_at:154:465; Interrogation_Position=8264; Antisense; GATTGCGTTCGCCATCGATGATGCT
>probe:Drosophila_2:1635954_at:499:317; Interrogation_Position=8286; Antisense; GCTCATGGACTGGATACTGGGCAAC

Paste this into a BLAST search page for me
GGATCTAGATTACGCCCTCATGATGGTGCAGTTGCTCGAGGAACGTGATCGAACGTGATCACCTGCAACTGAAGTAAGTTGTCGGACACACTGCGCCAGTAACTGAGCGGAGTCGCGTTAGCGATAGCGATGAACCAAGTGCCACGGCATAGCAGTCCCAGTAAAATCAGCAGTGACAGCGAACTTCTGGGCACGACGAGCAGCGGGCAGTGACCTCAAGCAGAAGCAGACGGTGAAGCATTCCAAGGACGCAGGGCTCGGGATCACAATCAGGAAGCAATAGGCGTGGATCTCTCTCAAGATTGCGTTCGCCATCGATGATGCTGCTCATGGACTGGATACTGGGCAAC

Full Affymetrix probeset data:

Annotations for 1635954_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime