Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635956_at:

>probe:Drosophila_2:1635956_at:30:363; Interrogation_Position=1109; Antisense; GCAATGAGCGCATACCCGAGGACGA
>probe:Drosophila_2:1635956_at:377:409; Interrogation_Position=1129; Antisense; GACGAGATCGTCCTGGAACAGCCGC
>probe:Drosophila_2:1635956_at:230:537; Interrogation_Position=1275; Antisense; GGTCAACTCCTCAAGGGAAGCGCCT
>probe:Drosophila_2:1635956_at:224:435; Interrogation_Position=1342; Antisense; GAGGGAAATGGCTCCGCACAGCTGC
>probe:Drosophila_2:1635956_at:493:85; Interrogation_Position=1372; Antisense; AGTGCCAGCACGGTCAGCGGTTTCG
>probe:Drosophila_2:1635956_at:176:695; Interrogation_Position=1392; Antisense; TTTCGGAGTGCGTCCACGGAGTAGT
>probe:Drosophila_2:1635956_at:184:405; Interrogation_Position=1424; Antisense; GACTGCACGCTTACACGGGATCGGT
>probe:Drosophila_2:1635956_at:30:721; Interrogation_Position=1467; Antisense; TTCCCGAGTGGATTTGCGTGATGCT
>probe:Drosophila_2:1635956_at:615:51; Interrogation_Position=1487; Antisense; ATGCTGACAAGGGATCGGCCATATA
>probe:Drosophila_2:1635956_at:282:21; Interrogation_Position=1507; Antisense; ATATATCTGGGCTGTTCGGCACCGA
>probe:Drosophila_2:1635956_at:631:135; Interrogation_Position=1540; Antisense; ACGCTATCTATATCCTCGTCGAGAG
>probe:Drosophila_2:1635956_at:390:313; Interrogation_Position=1612; Antisense; GCCAGTCCACGTCATGGCGTTAAAA
>probe:Drosophila_2:1635956_at:167:573; Interrogation_Position=1627; Antisense; GGCGTTAAAAGATCCACCAGTCTGG
>probe:Drosophila_2:1635956_at:337:373; Interrogation_Position=1667; Antisense; GAAGTCCAGAGCAAGCCGTCATTAG

Paste this into a BLAST search page for me
GCAATGAGCGCATACCCGAGGACGAGACGAGATCGTCCTGGAACAGCCGCGGTCAACTCCTCAAGGGAAGCGCCTGAGGGAAATGGCTCCGCACAGCTGCAGTGCCAGCACGGTCAGCGGTTTCGTTTCGGAGTGCGTCCACGGAGTAGTGACTGCACGCTTACACGGGATCGGTTTCCCGAGTGGATTTGCGTGATGCTATGCTGACAAGGGATCGGCCATATAATATATCTGGGCTGTTCGGCACCGAACGCTATCTATATCCTCGTCGAGAGGCCAGTCCACGTCATGGCGTTAAAAGGCGTTAAAAGATCCACCAGTCTGGGAAGTCCAGAGCAAGCCGTCATTAG

Full Affymetrix probeset data:

Annotations for 1635956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime