FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635959_at:

>probe:Drosophila_2:1635959_at:504:267; Interrogation_Position=103; Antisense; CAGGATAACACCAATGAGGATTCGT
>probe:Drosophila_2:1635959_at:687:77; Interrogation_Position=119; Antisense; AGGATTCGTCCAGTAATGATGGCGA
>probe:Drosophila_2:1635959_at:625:51; Interrogation_Position=13; Antisense; ATGCGATTCCTAATTGTCGTTGCTC
>probe:Drosophila_2:1635959_at:375:527; Interrogation_Position=144; Antisense; GGGAAACTCCGATGCTGCCGAGGAA
>probe:Drosophila_2:1635959_at:518:621; Interrogation_Position=156; Antisense; TGCTGCCGAGGAAGAACCTGCTGTT
>probe:Drosophila_2:1635959_at:124:249; Interrogation_Position=24; Antisense; AATTGTCGTTGCTCTTGTGGCCTTT
>probe:Drosophila_2:1635959_at:550:531; Interrogation_Position=292; Antisense; GGGTCTGATGATAATACCGAATCGG
>probe:Drosophila_2:1635959_at:29:77; Interrogation_Position=344; Antisense; AGGAGCAGGATGCTCCACCCAACAA
>probe:Drosophila_2:1635959_at:682:251; Interrogation_Position=363; Antisense; CAACAACCAGATTCGACCATTCGGA
>probe:Drosophila_2:1635959_at:522:555; Interrogation_Position=385; Antisense; GGACCTCTTCTCATCCAAGCAAGGC
>probe:Drosophila_2:1635959_at:682:249; Interrogation_Position=400; Antisense; CAAGCAAGGCCCCTTTTCCTCGATT
>probe:Drosophila_2:1635959_at:579:691; Interrogation_Position=48; Antisense; TTTGGCTGTTGGTCTTGTGGCTGCA
>probe:Drosophila_2:1635959_at:645:645; Interrogation_Position=60; Antisense; TCTTGTGGCTGCACGGCCAGCTGAG
>probe:Drosophila_2:1635959_at:525:549; Interrogation_Position=90; Antisense; GGAGTCCTCCATCCAGGATAACACC

Paste this into a BLAST search page for me
CAGGATAACACCAATGAGGATTCGTAGGATTCGTCCAGTAATGATGGCGAATGCGATTCCTAATTGTCGTTGCTCGGGAAACTCCGATGCTGCCGAGGAATGCTGCCGAGGAAGAACCTGCTGTTAATTGTCGTTGCTCTTGTGGCCTTTGGGTCTGATGATAATACCGAATCGGAGGAGCAGGATGCTCCACCCAACAACAACAACCAGATTCGACCATTCGGAGGACCTCTTCTCATCCAAGCAAGGCCAAGCAAGGCCCCTTTTCCTCGATTTTTGGCTGTTGGTCTTGTGGCTGCATCTTGTGGCTGCACGGCCAGCTGAGGGAGTCCTCCATCCAGGATAACACC

Full Affymetrix probeset data:

Annotations for 1635959_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720