Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635960_at:

>probe:Drosophila_2:1635960_at:473:279; Interrogation_Position=2915; Antisense; CTAAGCCTAGTATCTTATTGGCAAT
>probe:Drosophila_2:1635960_at:363:157; Interrogation_Position=3001; Antisense; ACACGCAGCAGTGTCTGCAACTGGA
>probe:Drosophila_2:1635960_at:19:563; Interrogation_Position=3023; Antisense; GGAAGTTGCACATCTTTCGAGCGAA
>probe:Drosophila_2:1635960_at:131:185; Interrogation_Position=3057; Antisense; AAAATGGATCCATTGTACTGCAATA
>probe:Drosophila_2:1635960_at:238:489; Interrogation_Position=3071; Antisense; GTACTGCAATATATAACCGATTCTT
>probe:Drosophila_2:1635960_at:347:465; Interrogation_Position=3097; Antisense; GATTGATTGATCTATGCTAACTATA
>probe:Drosophila_2:1635960_at:625:387; Interrogation_Position=3147; Antisense; GAAAATAGCAAATTCCCAGGCAATT
>probe:Drosophila_2:1635960_at:675:483; Interrogation_Position=3194; Antisense; GTATGCCGTTCGTTGATTGTGATCA
>probe:Drosophila_2:1635960_at:146:95; Interrogation_Position=3257; Antisense; AGTTCCAATGCTATACTTGATCTGG
>probe:Drosophila_2:1635960_at:477:725; Interrogation_Position=3273; Antisense; TTGATCTGGATCACGATCACGCCGC
>probe:Drosophila_2:1635960_at:208:631; Interrogation_Position=3299; Antisense; TCCGCGTTAACTAATGTATGTACAT
>probe:Drosophila_2:1635960_at:196:25; Interrogation_Position=3356; Antisense; ATATGAACACATACTCCGGATTATG
>probe:Drosophila_2:1635960_at:567:663; Interrogation_Position=3412; Antisense; TAAACGATGGCCGAGCAACTGCTAG
>probe:Drosophila_2:1635960_at:710:283; Interrogation_Position=3430; Antisense; CTGCTAGTGCGCGAATGGGCTTAGT

Paste this into a BLAST search page for me
CTAAGCCTAGTATCTTATTGGCAATACACGCAGCAGTGTCTGCAACTGGAGGAAGTTGCACATCTTTCGAGCGAAAAAATGGATCCATTGTACTGCAATAGTACTGCAATATATAACCGATTCTTGATTGATTGATCTATGCTAACTATAGAAAATAGCAAATTCCCAGGCAATTGTATGCCGTTCGTTGATTGTGATCAAGTTCCAATGCTATACTTGATCTGGTTGATCTGGATCACGATCACGCCGCTCCGCGTTAACTAATGTATGTACATATATGAACACATACTCCGGATTATGTAAACGATGGCCGAGCAACTGCTAGCTGCTAGTGCGCGAATGGGCTTAGT

Full Affymetrix probeset data:

Annotations for 1635960_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime