Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635961_at:

>probe:Drosophila_2:1635961_at:69:167; Interrogation_Position=4405; Antisense; AAATGAATTCCTGCACTTTGTGGGC
>probe:Drosophila_2:1635961_at:535:329; Interrogation_Position=4439; Antisense; GCGTGCATTGCCGAGCATCTGAAAC
>probe:Drosophila_2:1635961_at:451:421; Interrogation_Position=4474; Antisense; GAGATGAAAATATCGGGCGCCGCCT
>probe:Drosophila_2:1635961_at:228:495; Interrogation_Position=4499; Antisense; GTCACCGGCGAGTATTACCCAATAT
>probe:Drosophila_2:1635961_at:273:663; Interrogation_Position=4523; Antisense; TAAATCGCTAATGGCCACAGGCGGT
>probe:Drosophila_2:1635961_at:255:635; Interrogation_Position=4547; Antisense; TCGCCGCCCCAACTGTAATTGTGAA
>probe:Drosophila_2:1635961_at:587:653; Interrogation_Position=4562; Antisense; TAATTGTGAACGTCCGTGCGGCCAT
>probe:Drosophila_2:1635961_at:193:291; Interrogation_Position=4576; Antisense; CGTGCGGCCATTGCCCAAAAATGAT
>probe:Drosophila_2:1635961_at:289:447; Interrogation_Position=4677; Antisense; GATCGGCGCGGGATTTTGGCAAATC
>probe:Drosophila_2:1635961_at:434:717; Interrogation_Position=4692; Antisense; TTGGCAAATCGAGCTTCTTCTGCTT
>probe:Drosophila_2:1635961_at:198:339; Interrogation_Position=4729; Antisense; GCATAAGGCTTTGAGGCTTTCTTTT
>probe:Drosophila_2:1635961_at:241:657; Interrogation_Position=4757; Antisense; TAAGCAGGTGCTTCCAACTCGCTTT
>probe:Drosophila_2:1635961_at:712:341; Interrogation_Position=4777; Antisense; GCTTTGCTGGACAAATGCCCGACAT
>probe:Drosophila_2:1635961_at:608:475; Interrogation_Position=4804; Antisense; GTTACCATTCAAAATCGCTTGGCCA

Paste this into a BLAST search page for me
AAATGAATTCCTGCACTTTGTGGGCGCGTGCATTGCCGAGCATCTGAAACGAGATGAAAATATCGGGCGCCGCCTGTCACCGGCGAGTATTACCCAATATTAAATCGCTAATGGCCACAGGCGGTTCGCCGCCCCAACTGTAATTGTGAATAATTGTGAACGTCCGTGCGGCCATCGTGCGGCCATTGCCCAAAAATGATGATCGGCGCGGGATTTTGGCAAATCTTGGCAAATCGAGCTTCTTCTGCTTGCATAAGGCTTTGAGGCTTTCTTTTTAAGCAGGTGCTTCCAACTCGCTTTGCTTTGCTGGACAAATGCCCGACATGTTACCATTCAAAATCGCTTGGCCA

Full Affymetrix probeset data:

Annotations for 1635961_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime