FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635964_at:

>probe:Drosophila_2:1635964_at:67:637; Interrogation_Position=1940; Antisense; TCGGTTTCCAACGTTCGGCGAAGAT
>probe:Drosophila_2:1635964_at:655:219; Interrogation_Position=1979; Antisense; AAGTCCAACTGCCTCACAAGGTGAC
>probe:Drosophila_2:1635964_at:549:549; Interrogation_Position=2043; Antisense; GGAGGGCGGCTATGTTTACACCATG
>probe:Drosophila_2:1635964_at:527:237; Interrogation_Position=2094; Antisense; AATCAGGCACTGCAACTCGGTTGAT
>probe:Drosophila_2:1635964_at:541:81; Interrogation_Position=2180; Antisense; AGTGTACCATTGTCGCCTCGGAGGA
>probe:Drosophila_2:1635964_at:289:537; Interrogation_Position=2251; Antisense; GGTTCGACCAACTGTGGCCTGGGAC
>probe:Drosophila_2:1635964_at:185:119; Interrogation_Position=2325; Antisense; AGCGTTTACAAACTTTCTGGCCTCG
>probe:Drosophila_2:1635964_at:311:315; Interrogation_Position=2344; Antisense; GCCTCGGTCTACAAGTCGGAGCTGA
>probe:Drosophila_2:1635964_at:47:23; Interrogation_Position=2384; Antisense; ATATATTAGCTCTCTTCTCTTCCAA
>probe:Drosophila_2:1635964_at:443:225; Interrogation_Position=2407; Antisense; AAGGAGCAGTGCGACCGTGGCTATT
>probe:Drosophila_2:1635964_at:279:521; Interrogation_Position=2423; Antisense; GTGGCTATTACGTCCAGGTGCATGA
>probe:Drosophila_2:1635964_at:233:409; Interrogation_Position=2446; Antisense; GACGTTTATCCTTTGGCACATAGCG
>probe:Drosophila_2:1635964_at:506:25; Interrogation_Position=2465; Antisense; ATAGCGTTCTGGTGCTGGTAGACAC
>probe:Drosophila_2:1635964_at:39:133; Interrogation_Position=2494; Antisense; ACGCCACTAATATCCTCATACGAAG

Paste this into a BLAST search page for me
TCGGTTTCCAACGTTCGGCGAAGATAAGTCCAACTGCCTCACAAGGTGACGGAGGGCGGCTATGTTTACACCATGAATCAGGCACTGCAACTCGGTTGATAGTGTACCATTGTCGCCTCGGAGGAGGTTCGACCAACTGTGGCCTGGGACAGCGTTTACAAACTTTCTGGCCTCGGCCTCGGTCTACAAGTCGGAGCTGAATATATTAGCTCTCTTCTCTTCCAAAAGGAGCAGTGCGACCGTGGCTATTGTGGCTATTACGTCCAGGTGCATGAGACGTTTATCCTTTGGCACATAGCGATAGCGTTCTGGTGCTGGTAGACACACGCCACTAATATCCTCATACGAAG

Full Affymetrix probeset data:

Annotations for 1635964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720