FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635965_at:

>probe:Drosophila_2:1635965_at:293:151; Interrogation_Position=122; Antisense; ACATCGGACCGCAGGAGTTTCTTAA
>probe:Drosophila_2:1635965_at:602:707; Interrogation_Position=153; Antisense; TTACCACGGGCATTTAGCAGCACAT
>probe:Drosophila_2:1635965_at:649:669; Interrogation_Position=188; Antisense; TACTGGAACCCATGCAAGTGCGTGA
>probe:Drosophila_2:1635965_at:708:219; Interrogation_Position=203; Antisense; AAGTGCGTGATGAACCCTCCGTAAA
>probe:Drosophila_2:1635965_at:21:669; Interrogation_Position=250; Antisense; TACTACGCCCTGCTGATGGTGGATC
>probe:Drosophila_2:1635965_at:409:447; Interrogation_Position=271; Antisense; GATCCGGACGTACCCAATGCTATAA
>probe:Drosophila_2:1635965_at:503:93; Interrogation_Position=311; Antisense; AGTTCCTACACTGGATGGTCCTCAA
>probe:Drosophila_2:1635965_at:313:433; Interrogation_Position=444; Antisense; GAGGGACTACACCAAGTTTGACTTC
>probe:Drosophila_2:1635965_at:20:481; Interrogation_Position=459; Antisense; GTTTGACTTCCCGAAACTGCCGAAG
>probe:Drosophila_2:1635965_at:309:375; Interrogation_Position=480; Antisense; GAAGCACTCGGTTAAGGGTCGCAGT
>probe:Drosophila_2:1635965_at:80:667; Interrogation_Position=535; Antisense; TACAGATTTGGCCATCCGGTAGCTG
>probe:Drosophila_2:1635965_at:635:561; Interrogation_Position=560; Antisense; GGAACTTCTTCACATCCCAATGGAG
>probe:Drosophila_2:1635965_at:182:705; Interrogation_Position=602; Antisense; TTATCAAAGCCATCTCGCACAATGC
>probe:Drosophila_2:1635965_at:104:233; Interrogation_Position=622; Antisense; AATGCCCGTCAAGTAGCACACTTTT

Paste this into a BLAST search page for me
ACATCGGACCGCAGGAGTTTCTTAATTACCACGGGCATTTAGCAGCACATTACTGGAACCCATGCAAGTGCGTGAAAGTGCGTGATGAACCCTCCGTAAATACTACGCCCTGCTGATGGTGGATCGATCCGGACGTACCCAATGCTATAAAGTTCCTACACTGGATGGTCCTCAAGAGGGACTACACCAAGTTTGACTTCGTTTGACTTCCCGAAACTGCCGAAGGAAGCACTCGGTTAAGGGTCGCAGTTACAGATTTGGCCATCCGGTAGCTGGGAACTTCTTCACATCCCAATGGAGTTATCAAAGCCATCTCGCACAATGCAATGCCCGTCAAGTAGCACACTTTT

Full Affymetrix probeset data:

Annotations for 1635965_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720