Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635967_at:

>probe:Drosophila_2:1635967_at:212:247; Interrogation_Position=1357; Antisense; AATTGCGAACGGCAGAGCCTCTTTT
>probe:Drosophila_2:1635967_at:332:701; Interrogation_Position=1378; Antisense; TTTTGCCGCCAATCCGGGACAGCAG
>probe:Drosophila_2:1635967_at:302:305; Interrogation_Position=1444; Antisense; CCTGTTGCGTTTCCTGCAGAAGCTG
>probe:Drosophila_2:1635967_at:599:427; Interrogation_Position=1479; Antisense; GAGATTTATGTTACCCTTTGCCAAA
>probe:Drosophila_2:1635967_at:84:721; Interrogation_Position=1496; Antisense; TTGCCAAACCGAAAAGCCCACAGAG
>probe:Drosophila_2:1635967_at:136:265; Interrogation_Position=1516; Antisense; CAGAGAACCCCTACCTTACTGTCAA
>probe:Drosophila_2:1635967_at:562:669; Interrogation_Position=1532; Antisense; TACTGTCAACCGAAACCAGAGCGAT
>probe:Drosophila_2:1635967_at:517:173; Interrogation_Position=1626; Antisense; AAACCAACAGCAGCCTTACAGAAAA
>probe:Drosophila_2:1635967_at:348:191; Interrogation_Position=1765; Antisense; AACTATGCGAACATTTTACGGTAGA
>probe:Drosophila_2:1635967_at:519:391; Interrogation_Position=1788; Antisense; GAAACGACAACTAATAGCCGAGAAT
>probe:Drosophila_2:1635967_at:699:421; Interrogation_Position=1807; Antisense; GAGAATTTACAGTGCACGCCCAGAT
>probe:Drosophila_2:1635967_at:570:445; Interrogation_Position=1829; Antisense; GATGCAGCTAAACGCAAACGCACCT
>probe:Drosophila_2:1635967_at:220:173; Interrogation_Position=1844; Antisense; AAACGCACCTAACATTTTGCCCATA
>probe:Drosophila_2:1635967_at:460:243; Interrogation_Position=1921; Antisense; AATATTTATGCCAAGTTGTCAACTA

Paste this into a BLAST search page for me
AATTGCGAACGGCAGAGCCTCTTTTTTTTGCCGCCAATCCGGGACAGCAGCCTGTTGCGTTTCCTGCAGAAGCTGGAGATTTATGTTACCCTTTGCCAAATTGCCAAACCGAAAAGCCCACAGAGCAGAGAACCCCTACCTTACTGTCAATACTGTCAACCGAAACCAGAGCGATAAACCAACAGCAGCCTTACAGAAAAAACTATGCGAACATTTTACGGTAGAGAAACGACAACTAATAGCCGAGAATGAGAATTTACAGTGCACGCCCAGATGATGCAGCTAAACGCAAACGCACCTAAACGCACCTAACATTTTGCCCATAAATATTTATGCCAAGTTGTCAACTA

Full Affymetrix probeset data:

Annotations for 1635967_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime