FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635968_at:

>probe:Drosophila_2:1635968_at:240:253; Interrogation_Position=138; Antisense; CAAACCCCTGCCTGATGCCAGTGAG
>probe:Drosophila_2:1635968_at:297:85; Interrogation_Position=157; Antisense; AGTGAGCTCACTGTTCCGGAGGACT
>probe:Drosophila_2:1635968_at:355:549; Interrogation_Position=174; Antisense; GGAGGACTGTCATCAGCCCAAGGAA
>probe:Drosophila_2:1635968_at:547:249; Interrogation_Position=192; Antisense; CAAGGAAACCGGTCGCTGTTTCGCT
>probe:Drosophila_2:1635968_at:116:603; Interrogation_Position=208; Antisense; TGTTTCGCTCTGTTCTATCGCTACG
>probe:Drosophila_2:1635968_at:142:141; Interrogation_Position=239; Antisense; ACGTGGATACACAATCCTGCGAGGA
>probe:Drosophila_2:1635968_at:171:699; Interrogation_Position=269; Antisense; TTTACGGTGGATGTGCCGGCAACAA
>probe:Drosophila_2:1635968_at:379:711; Interrogation_Position=334; Antisense; TTGGTAAAGTCTGCGGTTTCCTCCA
>probe:Drosophila_2:1635968_at:309:523; Interrogation_Position=388; Antisense; GTGGCCACAGAAACTAGCACCTCGT
>probe:Drosophila_2:1635968_at:76:93; Interrogation_Position=40; Antisense; AGTTTCATAGTATTCGCGGCTGTTC
>probe:Drosophila_2:1635968_at:545:647; Interrogation_Position=450; Antisense; TCATCCAACTTCATCAGCCTTTTAA
>probe:Drosophila_2:1635968_at:17:173; Interrogation_Position=474; Antisense; AAAGCATTTCTTTACTGAGTTGATT
>probe:Drosophila_2:1635968_at:129:585; Interrogation_Position=71; Antisense; TGGCAGCCGGAATTCGTGCAGCTCC
>probe:Drosophila_2:1635968_at:324:117; Interrogation_Position=90; Antisense; AGCTCCCTCGGATGTCGTCGTGGAG

Paste this into a BLAST search page for me
CAAACCCCTGCCTGATGCCAGTGAGAGTGAGCTCACTGTTCCGGAGGACTGGAGGACTGTCATCAGCCCAAGGAACAAGGAAACCGGTCGCTGTTTCGCTTGTTTCGCTCTGTTCTATCGCTACGACGTGGATACACAATCCTGCGAGGATTTACGGTGGATGTGCCGGCAACAATTGGTAAAGTCTGCGGTTTCCTCCAGTGGCCACAGAAACTAGCACCTCGTAGTTTCATAGTATTCGCGGCTGTTCTCATCCAACTTCATCAGCCTTTTAAAAAGCATTTCTTTACTGAGTTGATTTGGCAGCCGGAATTCGTGCAGCTCCAGCTCCCTCGGATGTCGTCGTGGAG

Full Affymetrix probeset data:

Annotations for 1635968_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720