FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635969_at:

>probe:Drosophila_2:1635969_at:474:253; Interrogation_Position=195; Antisense; CAAAAGTTGTTGCTTCTCTTCCAGT
>probe:Drosophila_2:1635969_at:32:315; Interrogation_Position=229; Antisense; GCCAGTTCCAGTACCAATTCGAATT
>probe:Drosophila_2:1635969_at:243:35; Interrogation_Position=300; Antisense; ATCAGCGGCGACAGGCAATGCCTAT
>probe:Drosophila_2:1635969_at:47:265; Interrogation_Position=333; Antisense; CAGCAGCTCGGTGGCATTTGTGACC
>probe:Drosophila_2:1635969_at:276:271; Interrogation_Position=347; Antisense; CATTTGTGACCACTCCGGATCGGGA
>probe:Drosophila_2:1635969_at:165:595; Interrogation_Position=386; Antisense; TGGGCCGCAGCATCGTTGAGTTGAA
>probe:Drosophila_2:1635969_at:505:581; Interrogation_Position=413; Antisense; TGGCCGCATGCGTGAACATTGTGTC
>probe:Drosophila_2:1635969_at:221:729; Interrogation_Position=431; Antisense; TTGTGTCCCAAGTCGAGTCTATCTA
>probe:Drosophila_2:1635969_at:431:327; Interrogation_Position=476; Antisense; GCGAGGACTCCGAATATCTGTTGAT
>probe:Drosophila_2:1635969_at:365:467; Interrogation_Position=495; Antisense; GTTGATGATCAAGACGCGCACCAGC
>probe:Drosophila_2:1635969_at:476:451; Interrogation_Position=529; Antisense; GATCTGAGCAAGTTCATCCGCGAGA
>probe:Drosophila_2:1635969_at:67:235; Interrogation_Position=604; Antisense; AATCCGCCGTATCTCGATTGGATCG
>probe:Drosophila_2:1635969_at:224:465; Interrogation_Position=619; Antisense; GATTGGATCGCGCAGACGGTTCCCA
>probe:Drosophila_2:1635969_at:436:541; Interrogation_Position=636; Antisense; GGTTCCCACAAAGGCCGAGAGCAAA

Paste this into a BLAST search page for me
CAAAAGTTGTTGCTTCTCTTCCAGTGCCAGTTCCAGTACCAATTCGAATTATCAGCGGCGACAGGCAATGCCTATCAGCAGCTCGGTGGCATTTGTGACCCATTTGTGACCACTCCGGATCGGGATGGGCCGCAGCATCGTTGAGTTGAATGGCCGCATGCGTGAACATTGTGTCTTGTGTCCCAAGTCGAGTCTATCTAGCGAGGACTCCGAATATCTGTTGATGTTGATGATCAAGACGCGCACCAGCGATCTGAGCAAGTTCATCCGCGAGAAATCCGCCGTATCTCGATTGGATCGGATTGGATCGCGCAGACGGTTCCCAGGTTCCCACAAAGGCCGAGAGCAAA

Full Affymetrix probeset data:

Annotations for 1635969_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720