FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635970_at:

>probe:Drosophila_2:1635970_at:710:625; Interrogation_Position=1040; Antisense; TGCCGACAAGGTGCTGGCTTTGCTG
>probe:Drosophila_2:1635970_at:452:81; Interrogation_Position=1069; Antisense; AGGTGGGCATCCTACTGCACGGCAA
>probe:Drosophila_2:1635970_at:542:43; Interrogation_Position=1106; Antisense; ATCCGAGGTGGTCTTTCCCGAGAAG
>probe:Drosophila_2:1635970_at:720:109; Interrogation_Position=1126; Antisense; AGAAGGTGCTTTCCCATGCGAACGG
>probe:Drosophila_2:1635970_at:178:421; Interrogation_Position=1161; Antisense; GAGCAGATGATTCGCGCCAGAGATT
>probe:Drosophila_2:1635970_at:523:15; Interrogation_Position=1183; Antisense; ATTATATACTCTTTCGTTTCTCCCG
>probe:Drosophila_2:1635970_at:285:131; Interrogation_Position=1253; Antisense; ACCTCCTGCGGAAACACTTGACGTT
>probe:Drosophila_2:1635970_at:46:691; Interrogation_Position=1277; Antisense; TTTGAAGACTGTGGCCCGGGTGAAT
>probe:Drosophila_2:1635970_at:686:181; Interrogation_Position=1307; Antisense; AAAACGGTGGGAGCTGCTACTGCCA
>probe:Drosophila_2:1635970_at:16:497; Interrogation_Position=1368; Antisense; GTCAGCCGACAGGAGTACCACTGGA
>probe:Drosophila_2:1635970_at:287:213; Interrogation_Position=1467; Antisense; AAGAGCGAATCCCAGTCACTGACTT
>probe:Drosophila_2:1635970_at:166:55; Interrogation_Position=1512; Antisense; ATGAATCACTCAACAACTGGCTCCG
>probe:Drosophila_2:1635970_at:227:197; Interrogation_Position=1526; Antisense; AACTGGCTCCGTGGATGCGTAGCAT
>probe:Drosophila_2:1635970_at:683:41; Interrogation_Position=1549; Antisense; ATCGGATGATGATCTCCCAGCGGCG

Paste this into a BLAST search page for me
TGCCGACAAGGTGCTGGCTTTGCTGAGGTGGGCATCCTACTGCACGGCAAATCCGAGGTGGTCTTTCCCGAGAAGAGAAGGTGCTTTCCCATGCGAACGGGAGCAGATGATTCGCGCCAGAGATTATTATATACTCTTTCGTTTCTCCCGACCTCCTGCGGAAACACTTGACGTTTTTGAAGACTGTGGCCCGGGTGAATAAAACGGTGGGAGCTGCTACTGCCAGTCAGCCGACAGGAGTACCACTGGAAAGAGCGAATCCCAGTCACTGACTTATGAATCACTCAACAACTGGCTCCGAACTGGCTCCGTGGATGCGTAGCATATCGGATGATGATCTCCCAGCGGCG

Full Affymetrix probeset data:

Annotations for 1635970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720