FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635971_at:

>probe:Drosophila_2:1635971_at:396:629; Interrogation_Position=472; Antisense; TCCAGCGTGCCATTGATGTCCAAAT
>probe:Drosophila_2:1635971_at:252:163; Interrogation_Position=506; Antisense; AAATTAAGTCGCACTTCCACTCTGT
>probe:Drosophila_2:1635971_at:10:297; Interrogation_Position=536; Antisense; CGACACGAAACCTACTCTGTTCAAA
>probe:Drosophila_2:1635971_at:660:633; Interrogation_Position=551; Antisense; TCTGTTCAAAATCCCCAATTCCGAT
>probe:Drosophila_2:1635971_at:351:259; Interrogation_Position=592; Antisense; CACGGTGCAGATTTGCTGTTGCCAC
>probe:Drosophila_2:1635971_at:541:285; Interrogation_Position=607; Antisense; CTGTTGCCACGACCAGTTTTCAATA
>probe:Drosophila_2:1635971_at:474:233; Interrogation_Position=656; Antisense; AATGCTTCAAGCCTTCTGAGCTAGC
>probe:Drosophila_2:1635971_at:170:671; Interrogation_Position=681; Antisense; TAGAAATCCCAAACCGCCTATTAGG
>probe:Drosophila_2:1635971_at:89:141; Interrogation_Position=718; Antisense; ACAGGCTTCTTTGTCCTAACTGGTA
>probe:Drosophila_2:1635971_at:563:51; Interrogation_Position=746; Antisense; ATGCTCAGTTGTCTTTTCACATCGG
>probe:Drosophila_2:1635971_at:266:579; Interrogation_Position=769; Antisense; GGCCAACTTGCGATCAGAGGCGTTA
>probe:Drosophila_2:1635971_at:515:439; Interrogation_Position=785; Antisense; GAGGCGTTAGTGTCCAATCATGTAT
>probe:Drosophila_2:1635971_at:435:335; Interrogation_Position=853; Antisense; GCTAAGCTGACTATGGACCGCAAAA
>probe:Drosophila_2:1635971_at:477:633; Interrogation_Position=930; Antisense; TCCGCCAGAGACACATCATCAGGGT

Paste this into a BLAST search page for me
TCCAGCGTGCCATTGATGTCCAAATAAATTAAGTCGCACTTCCACTCTGTCGACACGAAACCTACTCTGTTCAAATCTGTTCAAAATCCCCAATTCCGATCACGGTGCAGATTTGCTGTTGCCACCTGTTGCCACGACCAGTTTTCAATAAATGCTTCAAGCCTTCTGAGCTAGCTAGAAATCCCAAACCGCCTATTAGGACAGGCTTCTTTGTCCTAACTGGTAATGCTCAGTTGTCTTTTCACATCGGGGCCAACTTGCGATCAGAGGCGTTAGAGGCGTTAGTGTCCAATCATGTATGCTAAGCTGACTATGGACCGCAAAATCCGCCAGAGACACATCATCAGGGT

Full Affymetrix probeset data:

Annotations for 1635971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720