FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635972_at:

>probe:Drosophila_2:1635972_at:117:685; Interrogation_Position=1051; Antisense; TATAGCAATGACCACACCTAGGTAT
>probe:Drosophila_2:1635972_at:641:677; Interrogation_Position=1075; Antisense; TAGATGGACCATCTGCTGTGCAGAC
>probe:Drosophila_2:1635972_at:410:591; Interrogation_Position=551; Antisense; TGGTGCCCATCGAAGTCGTCTGCCG
>probe:Drosophila_2:1635972_at:631:75; Interrogation_Position=635; Antisense; AGGAGCCCACCAGCTATGGCATCAT
>probe:Drosophila_2:1635972_at:85:585; Interrogation_Position=651; Antisense; TGGCATCATCTTCAATCATCGCTAT
>probe:Drosophila_2:1635972_at:509:163; Interrogation_Position=698; Antisense; AAATCATAACCCAACTGGCCGAGCT
>probe:Drosophila_2:1635972_at:603:333; Interrogation_Position=720; Antisense; GCTGGTCAACTCCAAGAACGTGGGT
>probe:Drosophila_2:1635972_at:399:547; Interrogation_Position=762; Antisense; GGAGGCCAAGAAATCCATCATCGTG
>probe:Drosophila_2:1635972_at:484:333; Interrogation_Position=800; Antisense; GCTGGTGTCTGCTTAGCGTGATCGA
>probe:Drosophila_2:1635972_at:631:121; Interrogation_Position=814; Antisense; AGCGTGATCGACAACTATCTGGAGT
>probe:Drosophila_2:1635972_at:517:83; Interrogation_Position=836; Antisense; AGTGCAAAAAGTTCAACCTGGCCGA
>probe:Drosophila_2:1635972_at:647:295; Interrogation_Position=858; Antisense; CGAGCTGGCCAATCCTAGCGATAAA
>probe:Drosophila_2:1635972_at:37:645; Interrogation_Position=886; Antisense; TCTTCCGGCGAAGGAGATTCCAAGT
>probe:Drosophila_2:1635972_at:138:501; Interrogation_Position=909; Antisense; GTCGGAGACTTCAGAGGTCGCCAAT

Paste this into a BLAST search page for me
TATAGCAATGACCACACCTAGGTATTAGATGGACCATCTGCTGTGCAGACTGGTGCCCATCGAAGTCGTCTGCCGAGGAGCCCACCAGCTATGGCATCATTGGCATCATCTTCAATCATCGCTATAAATCATAACCCAACTGGCCGAGCTGCTGGTCAACTCCAAGAACGTGGGTGGAGGCCAAGAAATCCATCATCGTGGCTGGTGTCTGCTTAGCGTGATCGAAGCGTGATCGACAACTATCTGGAGTAGTGCAAAAAGTTCAACCTGGCCGACGAGCTGGCCAATCCTAGCGATAAATCTTCCGGCGAAGGAGATTCCAAGTGTCGGAGACTTCAGAGGTCGCCAAT

Full Affymetrix probeset data:

Annotations for 1635972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720