FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635973_at:

>probe:Drosophila_2:1635973_at:533:665; Interrogation_Position=468; Antisense; TACAAGCACGTTTTCGACGGCCTTT
>probe:Drosophila_2:1635973_at:693:575; Interrogation_Position=486; Antisense; GGCCTTTTCCGCATCTACAAAGAGG
>probe:Drosophila_2:1635973_at:665:561; Interrogation_Position=576; Antisense; GGAACGAATGCAGCCTACGACCAAG
>probe:Drosophila_2:1635973_at:143:427; Interrogation_Position=634; Antisense; GAGAGGGAGTACCACTGCACTTTGC
>probe:Drosophila_2:1635973_at:636:7; Interrogation_Position=681; Antisense; ATTGCCGTGGTGATAACGCAGCCGC
>probe:Drosophila_2:1635973_at:581:353; Interrogation_Position=698; Antisense; GCAGCCGCTCGATGTGATCAAGACG
>probe:Drosophila_2:1635973_at:230:213; Interrogation_Position=717; Antisense; AAGACGACTTTCATGAACGCCCAGC
>probe:Drosophila_2:1635973_at:480:79; Interrogation_Position=764; Antisense; AGGTGCTTTTCTGAGTACCGCCAAA
>probe:Drosophila_2:1635973_at:79:577; Interrogation_Position=792; Antisense; GGCCCATTGGCCTTCTACAAGGGAT
>probe:Drosophila_2:1635973_at:327:223; Interrogation_Position=810; Antisense; AAGGGATTCATTCCGGCCCTGATAC
>probe:Drosophila_2:1635973_at:422:457; Interrogation_Position=830; Antisense; GATACGAGTGTCACCCAATACGATT
>probe:Drosophila_2:1635973_at:694:683; Interrogation_Position=854; Antisense; TATCACCTTCGTTTTGTACGAGCAG
>probe:Drosophila_2:1635973_at:688:459; Interrogation_Position=889; Antisense; GATTTGGATATCTGCCACCTGACAA
>probe:Drosophila_2:1635973_at:444:447; Interrogation_Position=919; Antisense; GATGCCCCAAAATTCGTATCCATTT

Paste this into a BLAST search page for me
TACAAGCACGTTTTCGACGGCCTTTGGCCTTTTCCGCATCTACAAAGAGGGGAACGAATGCAGCCTACGACCAAGGAGAGGGAGTACCACTGCACTTTGCATTGCCGTGGTGATAACGCAGCCGCGCAGCCGCTCGATGTGATCAAGACGAAGACGACTTTCATGAACGCCCAGCAGGTGCTTTTCTGAGTACCGCCAAAGGCCCATTGGCCTTCTACAAGGGATAAGGGATTCATTCCGGCCCTGATACGATACGAGTGTCACCCAATACGATTTATCACCTTCGTTTTGTACGAGCAGGATTTGGATATCTGCCACCTGACAAGATGCCCCAAAATTCGTATCCATTT

Full Affymetrix probeset data:

Annotations for 1635973_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720