Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635974_at:

>probe:Drosophila_2:1635974_at:609:149; Interrogation_Position=1009; Antisense; ACTTGCCGGACTTTGCTAACATGAC
>probe:Drosophila_2:1635974_at:558:437; Interrogation_Position=1038; Antisense; GAGGAACAGATTGCCTTCGCTATGC
>probe:Drosophila_2:1635974_at:547:717; Interrogation_Position=1053; Antisense; TTCGCTATGCAGATGTCCATGCAGG
>probe:Drosophila_2:1635974_at:647:409; Interrogation_Position=1086; Antisense; GACGACTCTGTTACCCAGCAAGCAA
>probe:Drosophila_2:1635974_at:335:209; Interrogation_Position=1105; Antisense; AAGCAAAGCGCCCAAAGACGGACGA
>probe:Drosophila_2:1635974_at:261:103; Interrogation_Position=1120; Antisense; AGACGGACGAGGCAAACGCTCCCAT
>probe:Drosophila_2:1635974_at:142:177; Interrogation_Position=1133; Antisense; AAACGCTCCCATGGACGTGGACGAG
>probe:Drosophila_2:1635974_at:367:79; Interrogation_Position=1168; Antisense; AGGTGATCGGAGACCCGGCCTTCTT
>probe:Drosophila_2:1635974_at:433:315; Interrogation_Position=1185; Antisense; GCCTTCTTGCAGAGCGTGCTGGAGA
>probe:Drosophila_2:1635974_at:710:549; Interrogation_Position=1205; Antisense; GGAGAATCTGCCTGGTGTTGATCCC
>probe:Drosophila_2:1635974_at:283:447; Interrogation_Position=1248; Antisense; GATGCTGTCGGTTCACTCAACAAGG
>probe:Drosophila_2:1635974_at:466:185; Interrogation_Position=1371; Antisense; AAAATCATTTGTAGCCGTCTTTCAA
>probe:Drosophila_2:1635974_at:574:695; Interrogation_Position=895; Antisense; TTTCGGGATCTGGACCTGGAAACGA
>probe:Drosophila_2:1635974_at:575:387; Interrogation_Position=993; Antisense; GAAACACCCGAGGACAACTTGCCGG

Paste this into a BLAST search page for me
ACTTGCCGGACTTTGCTAACATGACGAGGAACAGATTGCCTTCGCTATGCTTCGCTATGCAGATGTCCATGCAGGGACGACTCTGTTACCCAGCAAGCAAAAGCAAAGCGCCCAAAGACGGACGAAGACGGACGAGGCAAACGCTCCCATAAACGCTCCCATGGACGTGGACGAGAGGTGATCGGAGACCCGGCCTTCTTGCCTTCTTGCAGAGCGTGCTGGAGAGGAGAATCTGCCTGGTGTTGATCCCGATGCTGTCGGTTCACTCAACAAGGAAAATCATTTGTAGCCGTCTTTCAATTTCGGGATCTGGACCTGGAAACGAGAAACACCCGAGGACAACTTGCCGG

Full Affymetrix probeset data:

Annotations for 1635974_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime