Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635975_s_at:

>probe:Drosophila_2:1635975_s_at:167:503; Interrogation_Position=15; Antisense; GTCCAACTCACTCAGTCGAAAACGG
>probe:Drosophila_2:1635975_s_at:82:603; Interrogation_Position=174; Antisense; TGTTGTTGTTGTTTGATTTCGCGAG
>probe:Drosophila_2:1635975_s_at:360:13; Interrogation_Position=189; Antisense; ATTTCGCGAGTTTTTCACCCAGAAG
>probe:Drosophila_2:1635975_s_at:678:395; Interrogation_Position=220; Antisense; GACAATCTATGGACTGTTGGTGCAG
>probe:Drosophila_2:1635975_s_at:307:33; Interrogation_Position=248; Antisense; ATAATCGTTTGTAACTAGCCGCCTT
>probe:Drosophila_2:1635975_s_at:372:659; Interrogation_Position=259; Antisense; TAACTAGCCGCCTTTCTGAAGAGTC
>probe:Drosophila_2:1635975_s_at:462:641; Interrogation_Position=273; Antisense; TCTGAAGAGTCCCACTTCCGAGGAG
>probe:Drosophila_2:1635975_s_at:522:319; Interrogation_Position=314; Antisense; GCCCCAAGATCAGCCGGAGGATGAT
>probe:Drosophila_2:1635975_s_at:271:305; Interrogation_Position=371; Antisense; CCTGAACTTGGACTGACTGGCGACA
>probe:Drosophila_2:1635975_s_at:633:297; Interrogation_Position=416; Antisense; CCTTTTACCCCAAATTCGATGAGCT
>probe:Drosophila_2:1635975_s_at:637:417; Interrogation_Position=436; Antisense; GAGCTGACCGGCTGACCTAGAGAGC
>probe:Drosophila_2:1635975_s_at:312:395; Interrogation_Position=497; Antisense; GAAATCTGTCATAATCTTACGGCTA
>probe:Drosophila_2:1635975_s_at:261:331; Interrogation_Position=53; Antisense; GCGGTTCACTGATTGCCACTTAGTA
>probe:Drosophila_2:1635975_s_at:400:701; Interrogation_Position=89; Antisense; TTGTTAGATCAAGCGCGAACCTAGA

Paste this into a BLAST search page for me
GTCCAACTCACTCAGTCGAAAACGGTGTTGTTGTTGTTTGATTTCGCGAGATTTCGCGAGTTTTTCACCCAGAAGGACAATCTATGGACTGTTGGTGCAGATAATCGTTTGTAACTAGCCGCCTTTAACTAGCCGCCTTTCTGAAGAGTCTCTGAAGAGTCCCACTTCCGAGGAGGCCCCAAGATCAGCCGGAGGATGATCCTGAACTTGGACTGACTGGCGACACCTTTTACCCCAAATTCGATGAGCTGAGCTGACCGGCTGACCTAGAGAGCGAAATCTGTCATAATCTTACGGCTAGCGGTTCACTGATTGCCACTTAGTATTGTTAGATCAAGCGCGAACCTAGA

Full Affymetrix probeset data:

Annotations for 1635975_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime