FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635976_at:

>probe:Drosophila_2:1635976_at:50:485; Interrogation_Position=1571; Antisense; GTATGGATGGCTTCCGTGTGGTCAA
>probe:Drosophila_2:1635976_at:648:293; Interrogation_Position=1602; Antisense; CGAGGTGATCCGCAACGTAGACATT
>probe:Drosophila_2:1635976_at:29:189; Interrogation_Position=1705; Antisense; AACATGGGCCACTCGAACACGGAAA
>probe:Drosophila_2:1635976_at:355:395; Interrogation_Position=1726; Antisense; GAAATCGATGTGAATGGCCTGCGCA
>probe:Drosophila_2:1635976_at:445:223; Interrogation_Position=1771; Antisense; AAGGTGCGCTCCCAGGTGGATCACA
>probe:Drosophila_2:1635976_at:526:451; Interrogation_Position=1789; Antisense; GATCACATTATCTGGCCGGAGGGCA
>probe:Drosophila_2:1635976_at:511:217; Interrogation_Position=1813; Antisense; AAGTACATCATTCTTCTGGCCGAGG
>probe:Drosophila_2:1635976_at:493:71; Interrogation_Position=1840; Antisense; AGGCTGGTCAATCTGAGCTGCTCCA
>probe:Drosophila_2:1635976_at:28:583; Interrogation_Position=1910; Antisense; TGGCCCTGATCGAGCTTTTCAATGC
>probe:Drosophila_2:1635976_at:521:547; Interrogation_Position=1956; Antisense; GGATGTCTACTTGCTGCCCAAGAAG
>probe:Drosophila_2:1635976_at:118:557; Interrogation_Position=1983; Antisense; GGACGAGTATGTTGCCAGCCTGCAC
>probe:Drosophila_2:1635976_at:711:715; Interrogation_Position=2017; Antisense; TTCGATGCCCATTTGACGGAGCTGA
>probe:Drosophila_2:1635976_at:63:609; Interrogation_Position=2039; Antisense; TGAGCGACGAGCAGGCCAAGTACAT
>probe:Drosophila_2:1635976_at:451:663; Interrogation_Position=2098; Antisense; TACTACCGCTACTAGGACGCAAGGC

Paste this into a BLAST search page for me
GTATGGATGGCTTCCGTGTGGTCAACGAGGTGATCCGCAACGTAGACATTAACATGGGCCACTCGAACACGGAAAGAAATCGATGTGAATGGCCTGCGCAAAGGTGCGCTCCCAGGTGGATCACAGATCACATTATCTGGCCGGAGGGCAAAGTACATCATTCTTCTGGCCGAGGAGGCTGGTCAATCTGAGCTGCTCCATGGCCCTGATCGAGCTTTTCAATGCGGATGTCTACTTGCTGCCCAAGAAGGGACGAGTATGTTGCCAGCCTGCACTTCGATGCCCATTTGACGGAGCTGATGAGCGACGAGCAGGCCAAGTACATTACTACCGCTACTAGGACGCAAGGC

Full Affymetrix probeset data:

Annotations for 1635976_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720