Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635978_at:

>probe:Drosophila_2:1635978_at:539:661; Interrogation_Position=1552; Antisense; TAAACTAACTGATCGGAGGCGAGGA
>probe:Drosophila_2:1635978_at:201:439; Interrogation_Position=1567; Antisense; GAGGCGAGGATCTGTGCGCATATAT
>probe:Drosophila_2:1635978_at:409:711; Interrogation_Position=1601; Antisense; TTCTTGTTTACACATGCACACCATG
>probe:Drosophila_2:1635978_at:593:355; Interrogation_Position=1616; Antisense; GCACACCATGCGTCGCCAACTAAAA
>probe:Drosophila_2:1635978_at:511:205; Interrogation_Position=1673; Antisense; AAGCCCATCGGCAGACAAACTGAAC
>probe:Drosophila_2:1635978_at:728:373; Interrogation_Position=1715; Antisense; GAAGATTCGCTGAGCTTGCGGGAAT
>probe:Drosophila_2:1635978_at:687:717; Interrogation_Position=1730; Antisense; TTGCGGGAATCCCAAATTTTCCTAT
>probe:Drosophila_2:1635978_at:521:695; Interrogation_Position=1747; Antisense; TTTCCTATACTCTTTTGTTGCCCGT
>probe:Drosophila_2:1635978_at:262:603; Interrogation_Position=1762; Antisense; TGTTGCCCGTTTTAGTAATATTTAT
>probe:Drosophila_2:1635978_at:80:477; Interrogation_Position=1831; Antisense; GTTATTTGCAAACCAGAGAAACGAC
>probe:Drosophila_2:1635978_at:315:655; Interrogation_Position=1878; Antisense; TAATGACTTCGTTGGACTGCAGATC
>probe:Drosophila_2:1635978_at:112:729; Interrogation_Position=1889; Antisense; TTGGACTGCAGATCGCCGAGCAGGC
>probe:Drosophila_2:1635978_at:623:419; Interrogation_Position=1906; Antisense; GAGCAGGCTGTGTCAGTATCCAAGA
>probe:Drosophila_2:1635978_at:643:137; Interrogation_Position=1936; Antisense; ACTAGTTCTAGTTCCGTATTCAAAT

Paste this into a BLAST search page for me
TAAACTAACTGATCGGAGGCGAGGAGAGGCGAGGATCTGTGCGCATATATTTCTTGTTTACACATGCACACCATGGCACACCATGCGTCGCCAACTAAAAAAGCCCATCGGCAGACAAACTGAACGAAGATTCGCTGAGCTTGCGGGAATTTGCGGGAATCCCAAATTTTCCTATTTTCCTATACTCTTTTGTTGCCCGTTGTTGCCCGTTTTAGTAATATTTATGTTATTTGCAAACCAGAGAAACGACTAATGACTTCGTTGGACTGCAGATCTTGGACTGCAGATCGCCGAGCAGGCGAGCAGGCTGTGTCAGTATCCAAGAACTAGTTCTAGTTCCGTATTCAAAT

Full Affymetrix probeset data:

Annotations for 1635978_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime