Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635979_at:

>probe:Drosophila_2:1635979_at:657:329; Interrogation_Position=2684; Antisense; GCTGGACGTCAATTTTGGCGTACCA
>probe:Drosophila_2:1635979_at:414:573; Interrogation_Position=2700; Antisense; GGCGTACCACTATTCGATGTCGATA
>probe:Drosophila_2:1635979_at:297:309; Interrogation_Position=2753; Antisense; CCAGGGACTCTGTAGCGATGCTAAT
>probe:Drosophila_2:1635979_at:294:127; Interrogation_Position=2798; Antisense; AGCCAGCCAGGCACAAGTTCTCTTT
>probe:Drosophila_2:1635979_at:187:215; Interrogation_Position=2812; Antisense; AAGTTCTCTTTCTGGATTTCGTGCA
>probe:Drosophila_2:1635979_at:642:351; Interrogation_Position=2834; Antisense; GCAGCAGTGCTTGTACTTCGAGGAC
>probe:Drosophila_2:1635979_at:469:229; Interrogation_Position=2949; Antisense; AATGGTCGTTGAGCAGCGTACTCCT
>probe:Drosophila_2:1635979_at:469:53; Interrogation_Position=2977; Antisense; ATGCATTCCCCAAGTATTCCGTTTA
>probe:Drosophila_2:1635979_at:161:481; Interrogation_Position=3021; Antisense; GTTTGTGTACAGTTGGCGGACCGAT
>probe:Drosophila_2:1635979_at:102:139; Interrogation_Position=3076; Antisense; ACGTATATATATCCGCTACCGCATT
>probe:Drosophila_2:1635979_at:478:277; Interrogation_Position=3091; Antisense; CTACCGCATTCACATAAGCTAACCA
>probe:Drosophila_2:1635979_at:35:209; Interrogation_Position=3106; Antisense; AAGCTAACCAACCATCAGCCAAGTA
>probe:Drosophila_2:1635979_at:293:311; Interrogation_Position=3123; Antisense; GCCAAGTAAGTCAGCATCGCAGTCT
>probe:Drosophila_2:1635979_at:563:653; Interrogation_Position=3167; Antisense; TTATTAGTTTTGTAAGCTCCCAGGG

Paste this into a BLAST search page for me
GCTGGACGTCAATTTTGGCGTACCAGGCGTACCACTATTCGATGTCGATACCAGGGACTCTGTAGCGATGCTAATAGCCAGCCAGGCACAAGTTCTCTTTAAGTTCTCTTTCTGGATTTCGTGCAGCAGCAGTGCTTGTACTTCGAGGACAATGGTCGTTGAGCAGCGTACTCCTATGCATTCCCCAAGTATTCCGTTTAGTTTGTGTACAGTTGGCGGACCGATACGTATATATATCCGCTACCGCATTCTACCGCATTCACATAAGCTAACCAAAGCTAACCAACCATCAGCCAAGTAGCCAAGTAAGTCAGCATCGCAGTCTTTATTAGTTTTGTAAGCTCCCAGGG

Full Affymetrix probeset data:

Annotations for 1635979_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime