FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635987_at:

>probe:Drosophila_2:1635987_at:382:207; Interrogation_Position=1010; Antisense; AAGCTGATCAACATTCTGGAGGAGA
>probe:Drosophila_2:1635987_at:116:77; Interrogation_Position=1029; Antisense; AGGAGATATCCTTTGTCTCCGGTCA
>probe:Drosophila_2:1635987_at:240:641; Interrogation_Position=1044; Antisense; TCTCCGGTCACGATGTCGACTATTA
>probe:Drosophila_2:1635987_at:528:501; Interrogation_Position=1058; Antisense; GTCGACTATTACGACACCTTCGTTT
>probe:Drosophila_2:1635987_at:188:99; Interrogation_Position=1073; Antisense; ACCTTCGTTTTATGAGTAGCACCGT
>probe:Drosophila_2:1635987_at:514:557; Interrogation_Position=1120; Antisense; GGACTCGGTTCTAATCTTGGTTGAC
>probe:Drosophila_2:1635987_at:555:489; Interrogation_Position=1157; Antisense; GTACATGACTTGATCGCCTTGGAAA
>probe:Drosophila_2:1635987_at:105:63; Interrogation_Position=1199; Antisense; ATGTCCCAGATTTCAGACCTGCAAG
>probe:Drosophila_2:1635987_at:251:459; Interrogation_Position=1302; Antisense; GATTTCTATAGGTTTGCCATTCACA
>probe:Drosophila_2:1635987_at:551:105; Interrogation_Position=1396; Antisense; AGACAGGAATCACCGAAGCACACTC
>probe:Drosophila_2:1635987_at:667:109; Interrogation_Position=1412; Antisense; AGCACACTCCTTATATTTTACCTAT
>probe:Drosophila_2:1635987_at:297:349; Interrogation_Position=1518; Antisense; GCAGGCGTGAGTTTATGAGTCAGCA
>probe:Drosophila_2:1635987_at:444:625; Interrogation_Position=978; Antisense; TGCCGAGAATCAAGCCCTGCCAGGC
>probe:Drosophila_2:1635987_at:664:69; Interrogation_Position=999; Antisense; AGGCCACACTCAAGCTGATCAACAT

Paste this into a BLAST search page for me
AAGCTGATCAACATTCTGGAGGAGAAGGAGATATCCTTTGTCTCCGGTCATCTCCGGTCACGATGTCGACTATTAGTCGACTATTACGACACCTTCGTTTACCTTCGTTTTATGAGTAGCACCGTGGACTCGGTTCTAATCTTGGTTGACGTACATGACTTGATCGCCTTGGAAAATGTCCCAGATTTCAGACCTGCAAGGATTTCTATAGGTTTGCCATTCACAAGACAGGAATCACCGAAGCACACTCAGCACACTCCTTATATTTTACCTATGCAGGCGTGAGTTTATGAGTCAGCATGCCGAGAATCAAGCCCTGCCAGGCAGGCCACACTCAAGCTGATCAACAT

Full Affymetrix probeset data:

Annotations for 1635987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720