FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635989_at:

>probe:Drosophila_2:1635989_at:7:139; Interrogation_Position=303; Antisense; ACGAGGACTATTACAGCACTGCATT
>probe:Drosophila_2:1635989_at:48:145; Interrogation_Position=320; Antisense; ACTGCATTCTATATCTTCGCCTGGA
>probe:Drosophila_2:1635989_at:525:455; Interrogation_Position=343; Antisense; GATAAACAGCGACCTCATGTACCAT
>probe:Drosophila_2:1635989_at:82:213; Interrogation_Position=368; Antisense; AAGACTCCCGATAAGTTGCTCGTCG
>probe:Drosophila_2:1635989_at:414:637; Interrogation_Position=387; Antisense; TCGTCGAGGTTCTTCCCGGCGAGAA
>probe:Drosophila_2:1635989_at:522:109; Interrogation_Position=408; Antisense; AGAAGATCGCCATCCGCAGATTCTT
>probe:Drosophila_2:1635989_at:548:79; Interrogation_Position=438; Antisense; AGGTCAAGCCGCATCTTACCAAGTA
>probe:Drosophila_2:1635989_at:294:707; Interrogation_Position=453; Antisense; TTACCAAGTATCTGCGACTCAGTCG
>probe:Drosophila_2:1635989_at:70:565; Interrogation_Position=490; Antisense; GGAATTGGTTTCCAACGTCACCCAG
>probe:Drosophila_2:1635989_at:661:499; Interrogation_Position=537; Antisense; GTCTGATCACAACCTTCTTGGAGTT
>probe:Drosophila_2:1635989_at:673:725; Interrogation_Position=554; Antisense; TTGGAGTTTCCCCAGAACCTGAAGA
>probe:Drosophila_2:1635989_at:547:191; Interrogation_Position=582; Antisense; AACTTCCTGAGCTCCAGCTAATGGA
>probe:Drosophila_2:1635989_at:375:257; Interrogation_Position=613; Antisense; CAAATTGGCTCAGGCTTTGGTGCAG
>probe:Drosophila_2:1635989_at:11:695; Interrogation_Position=814; Antisense; TTTCCGACTGTCTGATCAACATGTG

Paste this into a BLAST search page for me
ACGAGGACTATTACAGCACTGCATTACTGCATTCTATATCTTCGCCTGGAGATAAACAGCGACCTCATGTACCATAAGACTCCCGATAAGTTGCTCGTCGTCGTCGAGGTTCTTCCCGGCGAGAAAGAAGATCGCCATCCGCAGATTCTTAGGTCAAGCCGCATCTTACCAAGTATTACCAAGTATCTGCGACTCAGTCGGGAATTGGTTTCCAACGTCACCCAGGTCTGATCACAACCTTCTTGGAGTTTTGGAGTTTCCCCAGAACCTGAAGAAACTTCCTGAGCTCCAGCTAATGGACAAATTGGCTCAGGCTTTGGTGCAGTTTCCGACTGTCTGATCAACATGTG

Full Affymetrix probeset data:

Annotations for 1635989_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720