FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635990_at:

>probe:Drosophila_2:1635990_at:678:577; Interrogation_Position=1055; Antisense; GGCCAGGACCCTTTGATCATGAGAG
>probe:Drosophila_2:1635990_at:213:725; Interrogation_Position=1067; Antisense; TTGATCATGAGAGCCAGCCCATTTC
>probe:Drosophila_2:1635990_at:167:499; Interrogation_Position=578; Antisense; GTCTGACTTGGCTTTTGTGCATAGA
>probe:Drosophila_2:1635990_at:170:477; Interrogation_Position=649; Antisense; GTTTTATGCCTAGAACTACGCCAAA
>probe:Drosophila_2:1635990_at:225:13; Interrogation_Position=673; Antisense; ATTCACCGACACAATTATGGCCTTC
>probe:Drosophila_2:1635990_at:328:525; Interrogation_Position=711; Antisense; GGAGACGAACCGCTTGGTCAAGCTA
>probe:Drosophila_2:1635990_at:357:1; Interrogation_Position=774; Antisense; ACGACGTTTTTCACGGAACTCTCAT
>probe:Drosophila_2:1635990_at:311:661; Interrogation_Position=814; Antisense; TAACTTTTCCTTGGTGTCCTTGTCG
>probe:Drosophila_2:1635990_at:243:367; Interrogation_Position=862; Antisense; GAAGGACCCCAAAGTTGTGGCCCAG
>probe:Drosophila_2:1635990_at:503:581; Interrogation_Position=879; Antisense; TGGCCCAGTTTGCAGTCCTTATGTT
>probe:Drosophila_2:1635990_at:460:681; Interrogation_Position=898; Antisense; TATGTTGCTCGCCTTAGGACATCTA
>probe:Drosophila_2:1635990_at:556:551; Interrogation_Position=941; Antisense; GGAGACCAGTTATCCCAGAAGTCAT
>probe:Drosophila_2:1635990_at:219:617; Interrogation_Position=966; Antisense; TGCAAATTTCGGAGGCTGCCTATGA
>probe:Drosophila_2:1635990_at:222:605; Interrogation_Position=988; Antisense; TGAGGCTTACGACCCAACCAAAGGA

Paste this into a BLAST search page for me
GGCCAGGACCCTTTGATCATGAGAGTTGATCATGAGAGCCAGCCCATTTCGTCTGACTTGGCTTTTGTGCATAGAGTTTTATGCCTAGAACTACGCCAAAATTCACCGACACAATTATGGCCTTCGGAGACGAACCGCTTGGTCAAGCTAACGACGTTTTTCACGGAACTCTCATTAACTTTTCCTTGGTGTCCTTGTCGGAAGGACCCCAAAGTTGTGGCCCAGTGGCCCAGTTTGCAGTCCTTATGTTTATGTTGCTCGCCTTAGGACATCTAGGAGACCAGTTATCCCAGAAGTCATTGCAAATTTCGGAGGCTGCCTATGATGAGGCTTACGACCCAACCAAAGGA

Full Affymetrix probeset data:

Annotations for 1635990_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720