FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635991_at:

>probe:Drosophila_2:1635991_at:347:419; Interrogation_Position=116; Antisense; GAGCTCTGCGAAATGTCTTGCGGAA
>probe:Drosophila_2:1635991_at:364:43; Interrogation_Position=146; Antisense; ATCGCAGTGATAAACCCCTTGTGGT
>probe:Drosophila_2:1635991_at:345:729; Interrogation_Position=247; Antisense; TTGGACAGTCTATCCTTCTATCTGC
>probe:Drosophila_2:1635991_at:260:283; Interrogation_Position=268; Antisense; CTGCGCACCCACGAAATCAATGTAA
>probe:Drosophila_2:1635991_at:599:173; Interrogation_Position=291; Antisense; AAAGCTGGCAGATCTCCTGGAGGAC
>probe:Drosophila_2:1635991_at:194:409; Interrogation_Position=313; Antisense; GACGAGTCCCAAGTTTCAGAAGCCC
>probe:Drosophila_2:1635991_at:538:51; Interrogation_Position=361; Antisense; ATGCTGTTGGCAATGGCTCTGATGT
>probe:Drosophila_2:1635991_at:106:301; Interrogation_Position=503; Antisense; CCCAGCATGGCGGAGAGTCTAGTCA
>probe:Drosophila_2:1635991_at:317:431; Interrogation_Position=517; Antisense; GAGTCTAGTCACAGCATATCGTATG
>probe:Drosophila_2:1635991_at:60:611; Interrogation_Position=542; Antisense; TGACCGGCGAGGGACATCACCACAA
>probe:Drosophila_2:1635991_at:669:333; Interrogation_Position=55; Antisense; GCTGTCCGTTCCGAAAACTGTGATC
>probe:Drosophila_2:1635991_at:160:201; Interrogation_Position=593; Antisense; AACCCTTGGCTTACAGAGGCTGGGA
>probe:Drosophila_2:1635991_at:386:195; Interrogation_Position=70; Antisense; AACTGTGATCAGGATGCCGGTGCCA
>probe:Drosophila_2:1635991_at:447:505; Interrogation_Position=89; Antisense; GTGCCACGCTATATTGTCGCGGTGA

Paste this into a BLAST search page for me
GAGCTCTGCGAAATGTCTTGCGGAAATCGCAGTGATAAACCCCTTGTGGTTTGGACAGTCTATCCTTCTATCTGCCTGCGCACCCACGAAATCAATGTAAAAAGCTGGCAGATCTCCTGGAGGACGACGAGTCCCAAGTTTCAGAAGCCCATGCTGTTGGCAATGGCTCTGATGTCCCAGCATGGCGGAGAGTCTAGTCAGAGTCTAGTCACAGCATATCGTATGTGACCGGCGAGGGACATCACCACAAGCTGTCCGTTCCGAAAACTGTGATCAACCCTTGGCTTACAGAGGCTGGGAAACTGTGATCAGGATGCCGGTGCCAGTGCCACGCTATATTGTCGCGGTGA

Full Affymetrix probeset data:

Annotations for 1635991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720