Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635993_at:

>probe:Drosophila_2:1635993_at:309:199; Interrogation_Position=1347; Antisense; AACGATGCCCGGAGTGCGCTGCACA
>probe:Drosophila_2:1635993_at:591:323; Interrogation_Position=1362; Antisense; GCGCTGCACAACTACATCCAGAGGA
>probe:Drosophila_2:1635993_at:602:51; Interrogation_Position=1404; Antisense; ATGCGATTCCAGACGCTCTTGGGCG
>probe:Drosophila_2:1635993_at:596:445; Interrogation_Position=1439; Antisense; GATGCACAAGGTCTCAAGCTTCACC
>probe:Drosophila_2:1635993_at:723:435; Interrogation_Position=1467; Antisense; GAGGAGCTGTTCTTCCGAAAGACCA
>probe:Drosophila_2:1635993_at:208:103; Interrogation_Position=1486; Antisense; AGACCATCGGCGACATCACCATTGT
>probe:Drosophila_2:1635993_at:163:647; Interrogation_Position=1516; Antisense; TCATCTCCGACATGTACAGTCAGCG
>probe:Drosophila_2:1635993_at:465:599; Interrogation_Position=1557; Antisense; TGTAGAGCCTAGACTAATCGCCGCA
>probe:Drosophila_2:1635993_at:112:637; Interrogation_Position=1583; Antisense; TCGAAGTGCCTTCCAAGTGCTGGGA
>probe:Drosophila_2:1635993_at:249:379; Interrogation_Position=1626; Antisense; GAAGCGCTTTGGACAATACTCGATC
>probe:Drosophila_2:1635993_at:178:713; Interrogation_Position=1666; Antisense; TTCTCATATCCAGGAGTCGAGCCTT
>probe:Drosophila_2:1635993_at:437:671; Interrogation_Position=1695; Antisense; TACGTACACAACACTCACCTTAATA
>probe:Drosophila_2:1635993_at:443:219; Interrogation_Position=1755; Antisense; AAGTCTCTCAGACCATCCAGATGTG
>probe:Drosophila_2:1635993_at:462:441; Interrogation_Position=1774; Antisense; GATGTGTTTCAAATTGCATTCGCAA

Paste this into a BLAST search page for me
AACGATGCCCGGAGTGCGCTGCACAGCGCTGCACAACTACATCCAGAGGAATGCGATTCCAGACGCTCTTGGGCGGATGCACAAGGTCTCAAGCTTCACCGAGGAGCTGTTCTTCCGAAAGACCAAGACCATCGGCGACATCACCATTGTTCATCTCCGACATGTACAGTCAGCGTGTAGAGCCTAGACTAATCGCCGCATCGAAGTGCCTTCCAAGTGCTGGGAGAAGCGCTTTGGACAATACTCGATCTTCTCATATCCAGGAGTCGAGCCTTTACGTACACAACACTCACCTTAATAAAGTCTCTCAGACCATCCAGATGTGGATGTGTTTCAAATTGCATTCGCAA

Full Affymetrix probeset data:

Annotations for 1635993_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime